Garcinia morella

(Gaertn.) Desr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Clusiaceae/Garcinia

At a glance

Occurrence records390

Data sources8

Biological traits11

DNA specimens5

eDNA detections5

Sources8 archives

Databases and archives Garcinia morella's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility390 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Chemical compositionNPASS62 compounds

Occurrence & distributionGBIF390 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Гарциния морелла — растение семейства Клузиевые, вид рода Гарциния, произрастающее в Таиланде, Камбодже, Южном Вьетнаме и на Филиппинах.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology1

Plant height15 m

Life cycle & reproduction2

Deciduousnessevergreen

Life spanperennial

Habitat & environment3

Climberself-supporting

Growth formtree

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)318 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density736 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition62 compounds

Compounds documented for Garcinia morella across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Plant xanthones25

Flavonols3

Methyl xanthones $ Plant xanthones3

Acyl phloroglucinols3

Flavanones $ Flavones2

Documented compounds62 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Morelloflavone	present	NPASS
(-)-Morellic Acid	present	NPASS
(1R,3E,5S,7S)-3-((3,4-dihydroxyphenyl)-hydroxymethylidene)-6,6-dimethyl-5,7-bis(3-methylbut-2-enyl)-1-((2R)-5-methyl-2-prop-1-en-2-ylhex-5-enyl)bicyclo(3.3.1)nonane-2,4,9-trione	present	NPASS
(2E)-2-Methyl-4-[(1R,3aS,5S,14aS)-3a,4,5,7-tetrahydro-8-hydroxy-3,3,11,11-tetramethyl-13-(3-methyl-2-buten-1-yl)-7,15-dioxo-1,5-methano-1H,3H,11H-furo[3,4-g]pyrano[3,2-b]xanthen-1-yl]-2-butenoic acid	present	NPASS
(2R)-2,6,9,11-tetrahydroxy-3,3-dimethyl-10-(3-methylbut-2-enyl)-1,2-dihydropyrano[3,2-a]xanthen-12-one	present	NPASS
(2Z)-4-[(1R,3aS,5S,14aS)-8-hydroxy-3,3,11,11-tetramethyl-13-(3-methylbut-2-en-1-yl)-7,15-dioxo-3a,4,5,7-tetrahydro-3H,11H-1,5-methanofuro[3,4-g]pyrano[3,2-b]xanthen-1-yl]-2-methylbut-2-enal	present	NPASS
(E)-4-[(1S,2S,15S,17S,19R)-12-hydroxy-8,8,21,21-tetramethyl-5-(3-methylbut-2-enyl)-14,18-dioxo-3,7,20-trioxahexacyclo[15.4.1.02,15.02,19.04,13.06,11]docosa-4(13),5,9,11-tetraen-19-yl]-2-methylbut-2-enal	present	NPASS
(E)-4-[(2R,17R,19S)-12-Hydroxy-8,8,21,21-tetramethyl-5-(3-methylbut-2-enyl)-14,18-dioxo-3,7,20-trioxahexacyclo[15.4.1.02,15.02,19.04,13.06,11]docosa-4(13),5,9,11,15-pentaen-19-yl]-2-methylbut-2-enal	present	NPASS
(Z)-4-[(1R,2R,17R,19S)-12-hydroxy-8,8,21,21-tetramethyl-5-(3-methylbut-2-enyl)-14,18-dioxo-3,7,20-trioxahexacyclo[15.4.1.02,15.02,19.04,13.06,11]docosa-4(13),5,9,11,15-pentaen-19-yl]-2-methylbut-2-enal	present	NPASS
(Z)-4-[(1R,2R,17R,19S)-12-hydroxy-8,8,21,21-tetramethyl-5-(3-methylbut-2-enyl)-14,18-dioxo-3,7,20-trioxahexacyclo[15.4.1.02,15.02,19.04,13.06,11]docosa-4(13),5,9,11,15-pentaen-19-yl]-2-methylbut-2-enoic acid	present	NPASS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Garcinia morella has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences10

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF990624.1 ↗254 bpIndia · 2015

ACGT

TAGCGTATGGCTCCTCAAGACGCAACAAACCAATCCCGGCGCGGGTTGCGCCAAGGAACTGTTGTAAATGTGAGGAACTCCTCTCCGTCT …

Garcinia morella isolate DU123 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★ITS5

plant barcodefungal barcode

08Occurrence & distribution

Record type390 records

Wild obs. + sensor304

Museum / vouchered86

Range

Area of Occupancy AOO392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 260≤1 km 29≤10 km 8>10 km 1

298 georeferenced · 6 without coordinates

Open the mapobservation + sensor304

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 86 records without

Open the institutions mapphysical evidence86

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	79
University of Stellenboschlocation not on record	3
Kew, GB	1

3 institutions · 83 of 86 vouchered records shown · 3 without an institution code

09Environmental DNA5 detections

Where the DNA of Garcinia morella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)