Garcinia lanceifolia — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Clusiaceae/Garcinia

At a glance

Occurrence records23

Data sources7

Biological traits7

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Garcinia lanceifolia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility23 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF23 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Garcinia lanceifolia is an endemic medicinal evergreen plant with edible fruit native to Asia, India, Bangladesh, Myanmar. It has been used by various ethnic communities across North-Eastern India for treatment of dysentery, dyspepsia and biliousness etc. It is also used as pickles in various North Eastern Indian cuisines. It is locally known as 'Rupohi Thekera' (ৰূপহী থেকেৰা) or 'Kon Thekera' (কণ- থেকেৰা) in Assamese, Chengkek in Mizo, Thisuru in Garo, Dieng-soh-jadu in Khasi and Khanada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formshrub or tree

Life spanperennial

Habitat & environment3

Climatewet tropical

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Garcinia lanceifolia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences9

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF990621.1 ↗238 bpIndia · 2015

ACGT

GCACATGGGTCTACTCAAGACGAAACACACCAATCCCGGCGCGGGATGCGCCAAGGAACTATTGTAAATGTTAAAAGGAACTCCTCTCCA …

Garcinia lanceifolia isolate DU128 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL2ITS6

plant barcodefungal barcode

08Occurrence & distribution

Record type23 records

Museum / vouchered23

Range

Area of Occupancy AOO68 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 4≤10 km 2

6 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence23

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kagoshima, JP	4
Xiamen, CN	3
Edinburgh, GB	2
Moscow State Universitylocation not on record	2
South Kensington, GB	1

5 institutions · 12 of 23 vouchered records shown · 11 without an institution code

09Environmental DNA2 detections

Where the DNA of Garcinia lanceifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.