Garcinia gaudichaudii

Planch. & Triana · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Clusiaceae/Garcinia

At a glance

Occurrence records51

Data sources8

Biological traits10

DNA specimens8

eDNA detections4

Sources8 archives

Databases and archives Garcinia gaudichaudii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility51 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS · NPASS64 compounds

Occurrence & distributionGBIF51 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Săng ngang hay còn gọi vàng nghệ, gỏi là một loài thực vật có hoa trong họ Bứa. Loài này được Planch. & Triana mô tả khoa học đầu tiên năm 1860.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Habitat & environment4

Climatewet tropical

Climberself-supporting

Growth formtree

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density720 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition64 compounds

Compounds documented for Garcinia gaudichaudii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Plant xanthones16

Dibenzylbutyrolactone lignans9

Furanoid lignans4

Minor lignans4

Flavones3

Documented compounds64 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Morellic Acid	present	LOTUS
(15S,1R,2R,13R)-5,15-Bis(3-methylbut-2-enyl)-6,8-dihydroxy-17,17-dimethyl-3,16-dioxapentacyclo[11.4.1.0<2,11>.0<2,15>.0<4,9>]octadeca-4(9),5,7,11-tetraene-10,14-dione	present	LOTUS
(1S,13S,15R)-6,8-dihydroxy-17,17-dimethyl-5,15-bis(3-methylbut-2-enyl)-3,16-dioxapentacyclo[11.4.1.02,11.02,15.04,9]octadeca-4,6,8,11-tetraene-10,14-dione	present	LOTUS
(1S,2S,17S,19R)-12-hydroxy-19-[(E)-4-hydroxy-3-methylbut-2-enyl]-8,8,21,21-tetramethyl-5-(3-methylbut-2-enyl)-3,7,20-trioxahexacyclo[15.4.1.02,15.02,19.04,13.06,11]docosa-4(13),5,9,11,15-pentaene-14,18-dione	present	LOTUS
(2E)-2-Methyl-4-[(1R,3aS,5S,14aS)-3a,4,5,7-tetrahydro-8-hydroxy-3,3,11,11-tetramethyl-13-(3-methyl-2-buten-1-yl)-7,15-dioxo-1,5-methano-1H,3H,11H-furo[3,4-g]pyrano[3,2-b]xanthen-1-yl]-2-butenoic acid	present	LOTUS
(2R,3R,4S)-4-[bis(7-methoxy-1,3-benzodioxol-5-yl)methyl]-3-methyloxolan-2-ol	present	NPASS
(3R,4R,7R)-14-hydroxy-5',6,6,18,18-pentamethyl-21-(3-methylbut-2-enyl)spiro[2,5,19-trioxapentacyclo[11.8.0.03,7.03,11.015,20]henicosa-1(13),10,14,16,20-pentaene-4,2'-3H-pyran]-6',9,12-trione	present	LOTUS
(3S,4S)-3-(hydroxymethyl)-4-[(S)-(7-methoxy-1,3-benzodioxol-5-yl)-(3,4,5-trimethoxyphenyl)methyl]oxolan-2-one	present	NPASS
(3S,4S)-4-[(R)-(7-hydroxy-1,3-benzodioxol-5-yl)-(7-methoxy-1,3-benzodioxol-5-yl)methyl]-3-methyloxolan-2-one	present	NPASS
(3S,4S)-4-[(S)-(3-hydroxy-4,5-dimethoxyphenyl)-(3,4,5-trimethoxyphenyl)methyl]-3-methyloxolan-2-one	present	NPASS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Garcinia gaudichaudii has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

GenBank sequences4

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMG817064.1 ↗595 bpIndonesia

ACGT

GTGTTAAAGAGTATAAATTGACTTATTATACTCCTGAGTATGAAACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAAC …

Garcinia gaudichaudii voucher KR1074 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2

plant barcode

08Occurrence & distribution

Record type51 records

Museum / vouchered51

Range

Area of Occupancy AOO124 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence51

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	7
Cibinong Science Center, Herbarium Bogorienselocation not on record	5
Columbia, US	1
Saint Louis, US	1

4 institutions · 14 of 51 vouchered records shown · 37 without an institution code

09Environmental DNA4 detections

Where the DNA of Garcinia gaudichaudii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 26.1–26.5

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C 29.5–29.8

Min temp (night)22.6 °C 22.6–22.9

Precipitation269 mm/mo 251–269

Air humidity68.1 % 66.9–68.1

Moisture balance133 mm/mo 112–133

Vapour deficit1,080 Pa 1,080–1,145

Wind speed1.20 m/s 1.20–1.40

Cloud cover57.6 % 55.2–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)