Garcinia dulcis

(Roxb.) Kurz · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Clusiaceae/Garcinia

At a glance

Occurrence records455

Data sources12

Biological traits30

DNA specimens18

eDNA detections8

Sources12 archives

Databases and archives Garcinia dulcis's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility455 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Chemical compositionLOTUS · NPASS325 compounds

Occurrence & distributionGBIF455 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD · NCBI18 specimens

01Narrative

Garcinia dulcis is a tropical fruit tree native to the Philippines, Java, Lesser Sunda Islands, eastern Indonesia (Sulawesi, Kalimantan, and the Maluku Islands), and Papua New Guinea. It was domesticated early and spread inland into mainland Asia. It is commonly known as mundu or munu in Indonesia and Malaysia, baniti or taklang-anak in the Philippines, and maphuut or ma phut in Thailand. The tree is harvested from the wild as a local source of food, medicine or dyeing material and is sometimes cultivated for its fruit, which is occasionally sold locally. Garcinia dulcis is not grown commercially.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology11

Fruit length42.5 mm

Fruit width47.5 mm

Leaf length162 mm

Leaf width70 mm

Petiole length2.05 cm

Plant height15 m

⚠ sources differ — GIFT: 15 m · AusTraits: 20 m

Seed length25 mm

Seed volume45 mm³

Seed volume max45 mm³

Seed volume min45 mm³

Seed width9 mm

Life cycle & reproduction5

Deciduousnessevergreen

Flowering timeyynnnnnnyyyy

Life formtree

Life spanperennial

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical oblong ovate

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density715 mg/cm³

03Chemical composition325 compounds

Compounds documented for Garcinia dulcis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Plant xanthones125

Polyprenylated cyclic polyketides (Hop meroterpenoids)14

Flavonols13

Flavones13

Flavanones $ Flavones12

Documented compounds325 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Isoxanthochymol	present	LOTUS
(+)-Morelloflavone	present	LOTUS
(+)-Volkensiflavone	present	LOTUS
(+/-)-Fukugiside	present	NPASS
(-)-Linalool	present	LOTUS
(-)-Morellic Acid	present	LOTUS
(1R,2R,13S,15S)-6,8-dihydroxy-13-methoxy-17,17-dimethyl-7-(2-methylbut-3-en-2-yl)-5,15-bis(3-methylbut-2-enyl)-3,16-dioxapentacyclo[11.4.1.02,11.02,15.04,9]octadeca-4(9),5,7,11-tetraene-10,14-dione	present	LOTUS
(1R,2R,7R,16S,18S)-11-hydroxy-16-methoxy-6,6,7,20,20-pentamethyl-18-(3-methylbut-2-enyl)-3,8,19-trioxahexacyclo[14.4.1.02,14.02,18.04,12.05,9]henicosa-4(12),5(9),10,14-tetraene-13,17-dione	present	LOTUS
(1R,2R,7R,16S,18S,20R)-11-hydroxy-20-(hydroxymethyl)-16-methoxy-6,6,7,20-tetramethyl-10,18-bis(3-methylbut-2-enyl)-3,8,19-trioxahexacyclo[14.4.1.02,14.02,18.04,12.05,9]henicosa-4(12),5(9),10,14-tetraene-13,17-dione	present	LOTUS
(1R,2R,7S,16S,18S)-11-hydroxy-16-methoxy-6,6,7,20,20-pentamethyl-10,18-bis(3-methylbut-2-enyl)-3,8,19-trioxahexacyclo[14.4.1.02,14.02,18.04,12.05,9]henicosa-4(12),5(9),10,14-tetraene-13,17-dione	present	LOTUS

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Garcinia dulcis has left across the world's sequence archives.

At a glance

DNA specimens18

Marker genes6

GenBank sequences6

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMF990625.1 ↗290 bpIndia · 2015

ACGT

TTACTCAAGGAACCCTTCTCCATCCTGGAAACAGTGTGTGCGACGAGGGCTTGTTCCTTTTAGTTGTAAACAAAACGACTCTCGGCAACG …

Garcinia dulcis isolate DU130 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL2★rbcLa★ITS4★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type455 records

Wild obs. + sensor8

Museum / vouchered429

Cultivated / captive3

Other15

Origin

Native1

Introduced2

Range

Area of Occupancy AOO832 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 5 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 20≤1 km 46≤10 km 100>10 km 9

175 georeferenced · 254 without coordinates

Open the institutions mapphysical evidence429

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	102
Brisbane, AU	55
Saint Louis, US	19
Xiamen, CN	12
Kew, GB	12
Cibinong, ID	10
Honolulu, US	10
St. Paul, US	8
Monastir, TN	6
Canberra, AU	6
University of Stellenboschlocation not on record	6
Museo Entomologico de Leonlocation not on record	5
Cibinong Science Center, Herbarium Bogorienselocation not on record	5
BISHlocation not on record	4
Llocation not on record	3
St. Augustine, TT	2
James Cook Townsvillelocation not on record	2
DOI/NPS, Colonial National Historical Parklocation not on record	2
Bronx, US	1
Burlington, US	1
Mount Annan, AU	1
Palmerston, AU	1
Ivano-Frankivsk, UA	1
Adam Mickiewicz University in Poznańlocation not on record	1
Fort Worth, US	1

25 institutions · 276 of 429 vouchered records shown · 152 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Garcinia dulcis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 23.7–26.8

Seasonal swing summer↔winter1.10 °C

Max temp (day)27.9 °C 26.4–29.1

Min temp (night)22.5 °C 21.1–24.9

Precipitation165 mm/mo 136–267

Air humidity68.9 % 64.8–72.6

Moisture balance153 mm/mo

Vapour deficit957 Pa 830–1,235

Wind speed1.80 m/s

Cloud cover52.2 % 50.8–61.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)