Garcinia celebica

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Clusiaceae/Garcinia

At a glance

Occurrence records301

Data sources11

Biological traits18

DNA specimens5

eDNA detections3

Sources11 archives

Databases and archives Garcinia celebica's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility301 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionLOTUS · NPASS75 compounds

Occurrence & distributionGBIF301 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceTreeOfSex2n = 96

01Narrative

Garcinia kingii is a species of flowering plant in the family Clusiaceae. It is found only in the Andaman Islands. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height20 m

Plant height max30 m

Seed volume1 500 mm³

Seed volume max1 500 mm³

Seed volume min1 500 mm³

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Habitat & environment6

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density800 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition75 compounds

Compounds documented for Garcinia celebica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Lanostane, Tirucallane and Euphane triterpenoids21

Germacrane sesquiterpenoids10

Cycloartane triterpenoids $ Lanostane, Tirucallane and Euphane triterpenoids9

Wax monoesters8

Guaiane sesquiterpenoids4

Documented compounds75 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Alpinetin	present	NPASS
(-)-Kaur-16-en-19-oic acid	present	NPASS
(1R,2R,3R,6S,8S,10R)-3,8-dimethyl-5,9,15-trioxatetracyclo[11.2.1.02,6.08,10]hexadec-13(16)-ene-4,14-dione	present	NPASS
(1R,2R,3R,6S,8S,10R,11R,12R)-11,12-dihydroxy-3,8-dimethyl-5,9,15-trioxatetracyclo[11.2.1.02,6.08,10]hexadec-13(16)-ene-4,14-dione	present	NPASS
(1R,2R,3R,6S,8S,10R,12R)-12-hydroxy-3,8-dimethyl-5,9,15-trioxatetracyclo[11.2.1.02,6.08,10]hexadec-13(16)-ene-4,14-dione	present	NPASS
(1R,9S,11S,15R,16S)-9-methyl-14-methylidene-2,6,12-trioxatetracyclo[7.6.1.04,16.011,15]hexadeca-4,7-diene-3,13-dione	present	NPASS
(1S,3S,7R,8R,12S,14S,16R)-16-hydroxy-14-methyl-9-methylidene-2,6,11,17-tetraoxapentacyclo[12.2.1.03,7.07,16.08,12]heptadecane-5,10-dione	present	NPASS
(1S,3S,7R,8R,9R,12S,14S,16R)-16-hydroxy-9,14-dimethyl-2,6,11,17-tetraoxapentacyclo[12.2.1.03,7.07,16.08,12]heptadecane-5,10-dione	present	NPASS
(1S,4R,9R,10R,13R,14S)-5,5,9-trimethyltetracyclo[11.2.1.01,10.04,9]hexadecan-14-ol	present	NPASS
(2E,4Z,6R)-6-[(1'aR,3R,3'R,3aS,3'aR,6S,7aR,7'aS)-6-hydroxy-3',3a,3'a,7,7-pentamethyl-6'-oxospiro[1,2,4,5,6,7a-hexahydroindene-3,7'-1a,2,4,5-tetrahydroindeno[3,3a-b]oxirene]-3'-yl]-2-methylhepta-2,4-dienoic acid	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Garcinia celebica has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR982452.1 ↗338 bpThailand · 2023

ACGT

GTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGTTGAGGGCACGTCTGCCTGGGTGTCA …

Garcinia celebica voucher BBH004382 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL6★rbcLa★ITS4★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceTreeOfSex

The complete instruction manual Garcinia celebica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 96 n = 48

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 961×TreeOfSex · plant

TreeOfSex · plant — Goldblatt1979 ↗

08Occurrence & distribution

Record type301 records

Wild obs. + sensor10

Museum / vouchered280

Cultivated / captive2

Other9

Range

Area of Occupancy AOO612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 2

4 georeferenced · 6 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 3≤10 km 6

9 georeferenced · 271 without coordinates

Open the institutions mapphysical evidence280

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Monastir, TN	32
Xiamen, CN	27
Kew, GB	24
University of Stellenboschlocation not on record	3
Saint Louis, US	3
Cibinong, ID	3
Llocation not on record	3
Taipei, TW	3
BISHlocation not on record	2
Honolulu, US	2
Paris, FR	2
Cibinong Science Center, Herbarium Bogorienselocation not on record	1
C. Ngernsaengsaruaylocation not on record	1
Bronx, US	1

14 institutions · 107 of 280 vouchered records shown · 173 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Garcinia celebica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 24.2–24.2

Seasonal swing summer↔winter0.6 °C

Max temp (day)25.8 °C

Min temp (night)23.1 °C

Precipitation397 mm/mo

Air humidity75.3 %

Moisture balance267 mm/mo

Vapour deficit746 Pa

Wind speed2.20 m/s

Cloud cover61.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)