Garcinia atroviridis

Griff. ex T.Anderson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Clusiaceae/Garcinia

At a glance

Occurrence records62

Data sources10

Biological traits10

DNA specimens3

eDNA detections2

Sources10 archives

Databases and archives Garcinia atroviridis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility62 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Chemical compositionLOTUS · NPASS31 compounds

Occurrence & distributionGBIF62 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Garcinia atroviridis, known as asam gelugur, asam gelugo, or asam keping (in Malay, ) is a large rainforest tree native to Peninsular MalaysiaHassan, Dr. W. E. (2006). Healing Herbs of Malaysia. Kuala Lumpur: Federal Land Development Agency. and Sumatra. This species grows wild throughout Peninsular Malaysia but is also widely cultivated, especially in the northern states, owing to its economic and medicinal value. Garcinia atroviridis is a large perennial plant commonly found in evergreen forests in the southern region of Thailand and Malaysia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology2

Plant height20 m

Plant height max27 m

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition31 compounds

Compounds documented for Garcinia atroviridis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Depsidones5

Isocoumarins2

Flavanones $ Flavones2

Naphthalenones $ Naphthoquinones2

Unsaturated fatty acids2

Documented compounds31 total

Tissue Source Quantified only

Compound	Amount	Source
(11S,17R,19R)-7,15,17,19-tetrahydroxypentacyclo[10.7.1.02,11.03,8.016,20]icosa-1,3(8),4,6,12(20),13,15-heptaen-9-one	present	LOTUS
(11S,17R,19R)-7,15,19-trihydroxy-17-methoxypentacyclo[10.7.1.02,11.03,8.016,20]icosa-1,3(8),4,6,12(20),13,15-heptaen-9-one	present	LOTUS
(2S,3R)-4-methoxyocta-4,6-diene-2,3-diol	present	LOTUS
(2S,3R,4E,6E)-4-methoxyocta-4,6-diene-2,3-diol	present	LOTUS
(3E,8aR)-3-benzylidene-2-methyl-6,7,8,8a-tetrahydropyrrolo[1,2-a]pyrazine-1,4-dione	present	LOTUS
(4R,6R)-4-Hydroxy-6-methyltetrahydro-2H-pyran-2-one	present	LOTUS
(8aR)-3-benzylidene-2-methyl-6,7,8,8a-tetrahydropyrrolo[1,2-a]pyrazine-1,4-dione	present	LOTUS
(S,E)-3-benzylidenehexahydropyrrolo[1,2-a]pyrazine-1,4-dione	present	LOTUS
1,2,3-Propanetricarboxylic acid, 1,2-dihydroxy-	present	LOTUS
14Z-docosenoic acid	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Garcinia atroviridis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences5

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAB110797.1 ↗619 bp

ACGT

TCGCAACCTGCCCAATAGCACGACCCGTGAACTCGTTTAACACATTCACAGGGGTGTGTGGTCAGTCGTTGGATTGGCAACATGCCACTG …

Garcinia atroviridis genes for internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type62 records

Wild obs. + sensor36

Museum / vouchered22

Cultivated / captive4

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 15≤1 km 6≤10 km 6

27 georeferenced · 9 without coordinates

Open the mapobservation + sensor36

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence22

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Monastir, TN	7
Kew, GB	2
Xiamen, CN	2
Edinburgh, GB	1
Cibinong Science Center, Herbarium Bogorienselocation not on record	1

5 institutions · 13 of 22 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Garcinia atroviridis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)