Garcinia aristata — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Clusiaceae/Garcinia

At a glance

Occurrence records47

Data sources9

Biological traits5

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Garcinia aristata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility47 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources5 traits

Chemical compositionLOTUS · NPASS5 compounds

Occurrence & distributionGBIF47 records

DNA & barcodingNCBIsequences

01Narrative

Garcinia aristata is a species of flowering plant in the family Clusiaceae. It is native to Cuba, and possibly Hispaniola and Puerto Rico.Garcinia aristata (Griseb.) Borhidi Specimens: http://www.tropicos.org/Name/100340222?tab=specimens It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment3

Climatewet tropical

Growth formtree

Woodinesswoody

03Chemical composition5 compounds

Compounds documented for Garcinia aristata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Polyprenylated cyclic polyketides (Hop meroterpenoids)4

Pulvinones1

Documented compounds5 total

Compound	Amount	Source
(1R,5S,7R)-3-[(3,4-dihydroxyphenyl)-hydroxymethylidene]-6,6-dimethyl-1,5,7-tris(3-methylbut-2-enyl)bicyclo[3.3.1]nonane-2,4,9-trione	present	LOTUS
aristophenone A	present	LOTUS
Pulvinic acid dilactone	present	NPASS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Garcinia aristata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPP228198.1 ↗157 933 bpChina

ACGT

CGACGGGAATTGAACCCGCGCATGATGGATTCACAATCCATTGCCTTGATCCACTTGGCTACATCCGCCCCGACTAATTGAGTTTGAAAT …

Garcinia aristata chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1

plant barcode

08Occurrence & distribution

Record type47 records

Museum / vouchered47

Range

Area of Occupancy AOO160 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence47

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	9
Saint Louis, US	3
South Kensington, GB	2
Miami, US	1

4 institutions · 15 of 47 vouchered records shown · 32 without an institution code