Garcinia acutifolia

N.Robson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Clusiaceae/Garcinia

At a glance

Occurrence records22

Data sources8

Biological traits7

DNA specimens2

eDNA detections1

Sources8 archives

Databases and archives Garcinia acutifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility22 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF22 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Garcinia acutifolia is a species of flowering plant in the family Clusiaceae. It is found in Mozambique and Tanzania. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Plant height2.5 m

Life cycle & reproduction3

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Habitat & environment3

Climateseasonally dry tropical

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: shrub/tree

Woodinesswoody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Garcinia acutifolia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKU568027.1 ↗552 bpMozambique · 2009

ACGT

GGTGTTGGATTCAAGGCTGGTGTTAAAGAGTATAAATTGACTTATTATACTCCTGAGTATGAAACAAAAGATACTGATATCTTGGCAGCA …

Garcinia acutifolia ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type22 records

Museum / vouchered22

Range

Area of Occupancy AOO56 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 22 records without

Open the institutions mapphysical evidence22

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	14
BMlocation not on record	1
Institute for Agricultural Research of Mozambiquelocation not on record	1
Coimbra, PT	1
LISClocation not on record	1
BPRHlocation not on record	1
Buffelskloof Private Nature Reserve, Herbariumlocation not on record	1

7 institutions · 20 of 22 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Garcinia acutifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 24.4–24.4

Seasonal swing summer↔winter3.80 °C

Max temp (day)28.8 °C

Min temp (night)20.7 °C

Precipitation8.20 mm/mo

Air humidity60.8 %

Moisture balance-136 mm/mo

Vapour deficit1,196 Pa

Wind speed2.40 m/s

Cloud cover12.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)