Gamochaeta purpurea
(L.) Cabrera · speciesAt a glance
Occurrence records7 504
Data sources11
Biological traits49
DNA specimens44
eDNA detections20
Sources11 archives
Databases and archives Gamochaeta purpurea's data was compiled from.
WikipediaWikimedia Foundation5 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility7 504 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics44 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources49 traits
Occurrence & distributionGBIF7 504 records
Environmental DNA1 datasets · 5 countries20 detections
DNA & barcodingBOLD · NCBI44 specimens
Genome at a glanceCCDB2n = 28
01Narrative
Gamochaeta purpurea, the purple cudweed, purple everlasting, or spoonleaf purple everlasting, is a plant native to North America.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology22
Fruit length0.6 mm
Fruit length max0.6 mm
Fruit length min0.5 mm
Fruit width max0.3 mm
Fruit width min0.2 mm
Leaf length55 mm
Leaf length max120 mm
Leaf length min50 mm
Leaf mass per area12.11 g/m2
Leaf size122 mm²
Leaf width11 mm
⚠ sources differ — AusTraits: 11 mm · GIFT: 7 mm
Leaf width max20 mm
Leaf width min7 mm
Plant height0.3 m
⚠ sources differ — GIFT: 0.3 m · AusTraits: 0.35 m · TRY: 0.042 m
Plant height max0.5 m
Plant height min0.1 m
Seed length0.7 mm
Seed length max0.7 mm
Seed length min0.7 mm
Seed mass0.034 mg
⚠ sources differ — TRY: 0.034 mg · AusTraits: 0.02 mg · GIFT: 0.038 mg
Seed mass max0.041 mg
Seed mass min0.032 mg
Life cycle & reproduction11
Dehiscenceindehiscent
Dispersal typewind
Flowering endJan
Flowering startOct
Life formannual, biennial or perennial
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: biennial · GIFT: annual
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max4 300 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTÁrea Antrópica, Campo de Altitude, Campo Limpo, Campo Rupestre
Leaf shapeobovate spathulate
Woodinessnon-woody
Physiology & chemistry3
Photosynthetic pathwayC3
Specific leaf area (SLA)8.12 mm²/mg
Wood density0 mg/cm³
Other traits1
Seeds per fruit>1000
05DNA & barcoding44 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gamochaeta purpurea has left across the world's sequence archives.
At a glance
DNA specimens44
Marker genes7
GenBank sequences10
eDNA detections20
Countries5
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCGTGTCGCCCCC …
Gamochaeta purpurea voucher PLT.0586 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL4★rbcLa★trnL-F★ITS6★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Gamochaeta purpurea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidypolyploid inferred
Chromosome records14–282n range28median28mode26records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2824×CCDB · croinout · CCDB · iber-fl · CCDB · fl-europaea +6
CCDB · croinout — Torres, A. M. & Liogier, A. H. 1970
CCDB · croinout — Fernandes, A. & Queiros, M. 1971
CCDB · croinout — Peng, C. I. & Hsu, C. C. 1977
CCDB · croinout — Peng, C. -I. & Hsu, C. -C. 1978
CCDB · croinout — Sidhu, M. K. 1979
CCDB · croinout — Bir, S. S. & Sidhu, M. 1979
CCDB · croinout — Bir, S. S. & Sidhu, M. 1980
CCDB · croinout — Sidhu, M. & Bir, S. S. 1983
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · fl-europaea — Fernandes &
CCDB · book-ipcn65 — Huynh 1965; Arano 1965
CCDB · ipcn-api-dl — Sidhu, M. & S. S. Bir. 1983. Karyological studies on weeds on cultivable lands in Punjab, India. Trop. Plant Sci. Res. 1: 1–13.
CCDB · ipcn-api-dl — Peng, C. i. & C. c. Hsu. 1978. Chromosome numbers in Taiwan Compositae. Bot. Bull. Acad. Sin. 19: 53–66.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1980. Cyto-palynological studies on weed flora of cultivable lands of Patiala district (Punjab). J. Palynol. 16: 85–105.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1979. Cytological observations in weed fiora of orchards of Paticla district, Punjab. Recent Res. Pl. Sci. (New Delhi). 7: 261–271.
CCDB · ipcn-api-dl — Peng, C. i. & C. c. Hsu. 1977. In IOPB chromosome number reports LVIII. Taxon 26: 557–565.
CCDB · book-ipcn67-71 — TORRES, A.M., & A.H. LIOGIER. 1970. Chromosome numbers of Dominican Compositae. Brittonia 22: 240-245.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · book-fedorov — Arano 1963c
CCDB · book-fedorov — Huynh 1965
CCDB · Cave1963 — Arano 1963c
CCDB · CromoCat 2015 — Sidhu, M. & S.S. Bir. (1983). Karyological studies on weeds on cultivable lands in Punjab, India. Trop. Plant Sci. Res. 1: 1-13.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1971a). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae. Bol. Soc. Brot. 45: 5-122.
CCDB · CromoCat 2015 — Peng, C. -I. (1977). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVIII]. Taxon 26(5/6): 562-564.
2n 142×CCDB · croinout · CCDB · book-ipcn73-74
CCDB · croinout — Banerjee, A. K. & Sharma, A. 1974
CCDB · book-ipcn73-74 — BANERJEE, A.K. & A. SHARMA. 1974. Chromosome studies on some Indian members of Compositae I. Tribe Inuloideae. Broteria, Ser. Bot. 43(70) 13-32.
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Keil, D. J. & Stuessy, T. F. (1977). Chromosome counts of Compositae from Mexico and the United States. Amer. J. Bot. 64: 791–798.
n 77×CCDB · croinout · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · croinout — Mehra, P. N. & Remanandan, P. 1969
CCDB · croinout — Banerjee, A. K. & Sharma, A. 1974
CCDB · croinout — Mehra, P. N. & Remanandan, P. 1975
CCDB · ipcn-api-dl — Mehra, P. N. & P. REMANANDAN. 1975. Cytological investigations on Indian Compositae. IV. Tribes Senecioneae, Eupatorieae, Vernonieae, and Inuleae. Nucleus 18: 6–19.
CCDB · book-ipcn67-71 — MEHRA, P.N., & P. REMANANDAN. 1969. In IOPB chromosome number repoI XXII. Taxon 18: 433-442.
CCDB · book-ipcn73-74 — BANERJEE, A.K. & A. SHARMA. 1974. Chromosome studies on some Indian members of Compositae I. Tribe Inuloideae. Broteria, Ser. Bot. 43(70) 13-32.
CCDB · CromoCat 2015 — Mehra, P. N. & P. Remanandan. (1969). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXII]. Taxon 18(3): 437-439.
n 147×CCDB · croinout · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · croinout — Keil, D. J. & Stuessy, T. F. 1977
CCDB · croinout — Hsu, C. -C. 1970
CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.
CCDB · ipcn-api-dl — Keil, D. J. & T. F. Stuessy. 1977. Chromosome counts of Compositae from Mexico and the United States. Amer. J. Bot. 64: 791–798.
CCDB · book-ipcn67-71 — HSU, c.-c. 1970. Preliminary chromosome studies on the vascular plants of Taiwan (III) The aster family, Compositae. Taiwania 15: 17-29.
CCDB · CromoCat 2015 — Mathew, A. & Mathew, P. M. (1988). Cytological studies on the south Indian Compositae Glimpses Pl. Res. 8: 1-177.
CCDB · CromoCat 2015 — Keil, D. J. & Stuessy, T. F. (1977). Chromosome counts of Compositae from Mexico and the United States. Amer. J. Bot. 64: 791–798.
n 92×CCDB · croinout · CCDB · book-ipcn67-71
CCDB · croinout — Gupta, P. K. 1969
CCDB · book-ipcn67-71 — GUPTA, P.K. 1969. Cytological investigations in some Indian Composi Cytologia 34: 429-438.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Sidhu, M. & S.S. Bir. (1983). Karyological studies on weeds on cultivable lands in Punjab, India. Trop. Plant Sci. Res. 1: 1-13.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~1.21 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin1.21 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type7 504 records
Wild obs. + sensor5 680
Museum / vouchered1 820
Cultivated / captive4
Origin
Native49
Introduced3 842
Range
Area of Occupancy AOO19 576 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy94% within 1 km
≤100 m 3 105≤1 km 2 026≤10 km 229>10 km 72
5 432 georeferenced · 248 without coordinates
Open the mapobservation + sensor5 680
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy49% within 1 km
≤100 m 157≤1 km 254≤10 km 327>10 km 101
839 georeferenced · 981 without coordinates
Open the institutions mapphysical evidence1 820
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 4 records without
Open the mapnot free-living4
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions116 of 212 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Museo Entomologico de Leonlocation not on record | 94 |
| Bronx, US | 90 |
| Wuzhou, CN | 78 |
| Chongqing Museumlocation not on record | 77 |
| Bangkok, TH | 75 |
| Saint Louis, US | 69 |
| Canberra, AU | 61 |
| University of Stellenboschlocation not on record | 56 |
| Mount Annan, AU | 45 |
| Jena Microbial Resource Collectionlocation not on record | 44 |
| Jackson, US | 42 |
| Bloomington, US | 39 |
| Austin, US | 38 |
| Hobart, AU | 37 |
| Fort Worth, US | 35 |
| Christchurch, NZ | 33 |
| Puerto Ayora, EC | 32 |
| Auckland, NZ | 28 |
| Pullman, US | 27 |
| Universidad de Caldas (UCaldas)location not on record | 24 |
| Toyama, JP | 23 |
| Chapel Hill, US | 23 |
| Tampa, US | 19 |
| Brisbane, AU | 19 |
| Valdosta State Universitylocation not on record | 18 |
| Jardín Botánico de Bogotá José Celestino Mutis (JBB)location not on record | 18 |
| Adelaide, AU | 16 |
| Universidad Nacional de Colombia (UNAL)location not on record | 16 |
| College Park, US | 15 |
| ASUlocation not on record | 15 |
| Mississippi State, US | 15 |
| Kew, GB | 14 |
| Wellington, NZ | 13 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 13 |
| Clemson, US | 13 |
| Kochi, JP | 13 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 12 |
| US | 11 |
| Mexico City, MX | 10 |
| Tuxtla Gutiérrez, MX | 10 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 10 |
| Williamsburg, US | 10 |
| Emporia, US | 9 |
| Little Rock, US | 9 |
| AUAlocation not on record | 8 |
| Columbia, US | 8 |
| Dover, US | 8 |
| Pelotas, BR | 8 |
| Tall Timbers Research Stationlocation not on record | 8 |
| Xiamen, CN | 8 |
| GAlocation not on record | 8 |
| UTFPR-CPlocation not on record | 7 |
| BISHlocation not on record | 7 |
| Fayetteville, US | 7 |
| Pittsburg, US | 7 |
| Campo Mourão, BR | 7 |
| Johnson City, US | 6 |
| DOI/NPS, Greenbelt Parklocation not on record | 6 |
| Stockholm, SE | 6 |
| CASlocation not on record | 6 |
| Rotorua, NZ | 6 |
| National Institute of Biological Resourceslocation not on record | 6 |
| Burlington, US | 5 |
| Ann Arbor, US | 5 |
| QVMAGlocation not on record | 5 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 5 |
| Springfield, US | 5 |
| Davis, US | 5 |
| National Museums of Kenyalocation not on record | 5 |
| Valparaiso, CL | 5 |
| Fairfax, US | 5 |
| Riverside, US | 5 |
| University of Southern Mississippilocation not on record | 4 |
| John T. Waterhouse Herbariumlocation not on record | 4 |
| Loja, EC | 4 |
| Honolulu, US | 4 |
| SSNHlocation not on record | 4 |
| Palmerston North, NZ | 4 |
| Chadron, US | 4 |
| South Kensington, GB | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record | 4 |
| Smithsonian Institutionlocation not on record | 4 |
| Santa Cruz, US | 4 |
| MeiseBGlocation not on record | 4 |
| New Brunswick, US | 4 |
| Badajoz, ES | 3 |
| Palmerston, AU | 3 |
| Sendai, JP | 3 |
| Fukushima Universitylocation not on record | 3 |
| Conway, US | 3 |
| EL PASO, US | 3 |
| Dekalb, US | 3 |
| Olocation not on record | 3 |
| Henderson State Universitylocation not on record | 3 |
| Durham, US | 3 |
| Ural Federal University "B. N. Yeltsin"location not on record | 3 |
| JBRJlocation not on record | 3 |
| CJBGlocation not on record | 3 |
| Western Carolina Universitylocation not on record | 3 |
| Tuscaloosa, US | 3 |
| La Trobe Universitylocation not on record | 3 |
| GB | 3 |
| Cambridge, US | 3 |
| Knoxville, US | 3 |
| Chicago, US | 3 |
| IPA/SPlocation not on record | 3 |
| Sagamihara, JP | 3 |
| Herbarium of South China Botanical Gardenlocation not on record | 3 |
| Chicago, US | 2 |
| Giardini Botanici Hanburylocation not on record | 2 |
| Severin-McDaniel Insect Collectionlocation not on record | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| Vancouver, CA | 2 |
| Santa Barbara, US | 2 |
| Blumenau, BR | 2 |
| Arequipa, PE | 2 |
| Ivano-Frankivsk, UA | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| Frankfurt am Main | 2 |
| Armidale, AU | 2 |
| Columbus State Universitylocation not on record | 2 |
| Cascavel, BR | 2 |
| Universidad Nacional Mayor de San Marcos, Museo de Historia Naturallocation not on record | 2 |
| Stephenville, US | 2 |
| UFSClocation not on record | 2 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 2 |
| Smithfield, AU | 2 |
| UFMGlocation not on record | 2 |
| G. Peyrelocation not on record | 2 |
| San Diego, US | 2 |
| University of Tennessee at Chattanoogalocation not on record | 2 |
| Charleston Southern Universitylocation not on record | 2 |
| BAYLUlocation not on record | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| USP-IBlocation not on record | 2 |
| UEMlocation not on record | 1 |
| Quito, EC | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| La Paz, BO | 1 |
| CUVClocation not on record | 1 |
| Tokushima, JP | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| Kawasaki Shi Tama Ku, JP | 1 |
| UNESClocation not on record | 1 |
| Brasília, BR | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| Glocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
| Cambridge University Herbariumlocation not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| Montréal, CA | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| UERJlocation not on record | 1 |
| Phoenix, US | 1 |
| Zacatecas, MX | 1 |
| Corvallis, US | 1 |
| Mount Berry, US | 1 |
| Missouri Department of Conservationlocation not on record | 1 |
| Minia, EG | 1 |
| Millersville, US | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| QCNElocation not on record | 1 |
| Philadelphia, US | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| UNICAMPlocation not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| Criciúma, BR | 1 |
| Portland, US | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Wlocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Lubbock, US | 1 |
| Uberlândia, BR | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| Viña del Mar, CL | 1 |
| Florida Museum of Natural Historylocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Batemans Bay, AU | 1 |
| San Luis Potosí, MX | 1 |
| CIBIOlocation not on record | 1 |
| MAlocation not on record | 1 |
| Zapopan, MX | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| PRClocation not on record | 1 |
| Beijing, CN | 1 |
| Miami, US | 1 |
| FUVATESlocation not on record | 1 |
| Northridge, US | 1 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 1 |
| Guasave, MX | 1 |
| UTFPR-DVlocation not on record | 1 |
| Conway, US | 1 |
| INMAlocation not on record | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| Porto Alegre, BR | 1 |
| Wollongong, AU | 1 |
| San Sebastián, ES | 1 |
| Tempe, US | 1 |
| Universidade Tecnológica Federal do Paranálocation not on record | 1 |
| US | 1 |
| Université de Bordeauxlocation not on record | 1 |
| Aarhus, DK | 1 |
| San Angelo, US | 1 |
| Lincoln, US | 1 |
| Parkville, AU | 1 |
212 institutions · 1 800 of 1 820 vouchered records shown · 18 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA20 detections
Where the DNA of Gamochaeta purpurea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found20
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 20 detections have coordinates
Open the map5 countries0
growing in a seasonal strem,nearcyperus
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.5 °C 15.6–22.0
Seasonal swing summer↔winter7.80 °C
Max temp (day)20.7 °C 18.8–27.5
Min temp (night)14.2 °C 10.4–16.7
Precipitation17.4 mm/mo 1.50–79.8
Air humidity57.7 % 51.9–69.6
Moisture balance-108 mm/mo -128–-19.6
Vapour deficit807 Pa 572–1,152
Wind speed3.00 m/s 2.10–5.00
Cloud cover41.2 % 24.1–59.5
CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.