Gamelia septentrionalis

Bouvier, 1936 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Gamelia

At a glance

Occurrence records86

Data sources7

Biological traits0

DNA specimens201

eDNA detections201

Sources7 archives

Databases and archives Gamelia septentrionalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility86 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI201 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics201 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF86 records

Environmental DNA1 datasets · 3 countries201 detections

DNA & barcodingBOLD201 specimens

01Narrative

Gamelia septentrionalis is a moth of the family Saturniidae. It is found in Central America, including Costa Rica and Nicaragua.BOLD Systems - Taxonomy Browser The larvae feed on Guatteria diospyroides, Clethra unnata, Dipteryx panamensis, Inga species, Senna fruticosa and Miriocarpa longipes.caterpillars.unr.edu

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding201 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gamelia septentrionalis has left across the world's sequence archives.

At a glance

DNA specimens201

BINs1

Marker genes1

eDNA detections201

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus197 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

AACTTTATATTTTATTTTTGGAATCTGAGCAGGAATAGTAGGAACTTCATTAAGATTGCTAATTCGAGCTGAATTAGGAACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.04%

Haplotypes9

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gamelia denhezisame genus6.2%Gamelia bolivietteisame genus6.8%Gamelia junietteisame genus7.0%Gamelia vanschayckisame genus7.1%Gamelia rubrilunasame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type86 records

Wild obs. + sensor1

Museum / vouchered85

Range

Area of Occupancy AOO96 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence85

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	78
University of Pennsylvanialocation not on record	3
South Kensington, GB	3
Zürich, CH	1

4 institutions · 85 of 85 vouchered records shown

09Environmental DNA201 detections

Where the DNA of Gamelia septentrionalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found201

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 201 detections have coordinates

Open the map3 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland | 1.6. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 21.9–26.2

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.9 °C 25.1–29.0

Min temp (night)22.2 °C 18.7–24.1

Precipitation325 mm/mo 83.3–472

Air humidity71.2 % 67.3–75.7

Moisture balance167 mm/mo -44.1–336

Vapour deficit831 Pa 699–1,097

Wind speed1.90 m/s 1.10–3.60

Cloud cover31.5 % 16.1–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 195 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)