Galium triflorum
Michx. · speciesAt a glance
Occurrence records22 177
Data sources16
Biological traits29
DNA specimens60
eDNA detections29
Sources16 archives
Databases and archives Galium triflorum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility22 177 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics60 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources29 traits
Chemical compositionLOTUS · NPASS12 compounds
Occurrence & distributionGBIF22 177 records
Environmental DNA1 datasets · 3 countries29 detections
DNA & barcodingBOLD · NCBI60 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex1.7 Gbp
01Narrative
Подмаренник трёхцветковый — вид многолетних травянистых растений из рода Подмаренник семейства Мареновые.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPLEDAGIFTTRY
Size & morphology7
Plant height0.118 m
Plant height generative0.155 m
Plant height max0.6 m
Plant height min0.25 m
Seed mass0.79 mg
Seed mass max0.96 mg
Seed mass min0.679 mg
Life cycle & reproduction6
Dispersal typeanimal
Flowering endAug
Flowering startJun
Life formsubshrub
Life spanperennial
Raunkiær life formchamaephyte
Diet & foraging1
Parasiteindependent
Habitat & environment7
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Habitat GIFTforest
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio27.3 g/g
Leaf c347 mg/g
Leaf dry-matter content (LDMC)141 mg/g
Leaf n17.88 mg/g
Leaf p2.17 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)67.02 mm²/mg
03Chemical composition12 compounds
Compounds documented for Galium triflorum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Illudalane sesquiterpenoids4
Documented compounds12 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 3,4-Dihydro-2H-1-benzopyran-2-one | present | LOTUS | |
| DVWGIWHUFAGTJO-IWAWTMINSA-N | present | NPASS | |
| DVWGIWHUFAGTJO-KUVSSKLUSA-N | present | NPASS | |
| GPHSJPVUEZFIDE-YITBWLPSSA-N | present | NPASS | |
| Onitin | present | NPASS | |
| Pterosin H | present | NPASS | |
| Pterosin I | present | NPASS | |
| Pterosin Z | present | NPASS | |
| QZJJJZCOOVXKLT-YFHOEESVSA-N | present | NPASS | |
| RYLFQOVBQSESBN-HOJIOWHPSA-N | present | NPASS |
05DNA & barcoding60 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galium triflorum has left across the world's sequence archives.
At a glance
DNA specimens60
Marker genes6
GenBank sequences10
eDNA detections29
Countries4
The DNA barcodea real sequence read deposited for this species
CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAGACGACCGCGAACACGTTAAACAAAACCGCGGGGCGCCGGT …
Galium triflorum voucher YangLE501 (KUN) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL5★rbcLa★ITS2★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Galium triflorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 711 500 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Galium triflorum1.71 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 66 n = 33
Ploidy2× diploid · measured
Chromosome records66–662n range66median66mode5records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 665×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +2
GoaT · Tree of Sex Database — ↗
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · book-ipcn75-78 — Moore 1975a
CCDB · book-ipcn73-74 — KLIPHUIS, E. 1974. Cytotaxonomic notes on some Galium species A. Proc. Kon. Ned. Acad. Wetensch. ser. C 77: 345-35-7-.-----
TreeOfSex · plant — Goldblatt1979 ↗
n 111×CCDB · Cave1963
CCDB · Cave1963 — Khoshoo & Bhat. 1963a
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
08Occurrence & distribution
Record type22 177 records
Wild obs. + sensor13 939
Museum / vouchered8 236
Fossil1
Other1
Origin
Native6
Range
Area of Occupancy AOO58 436 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy84% within 1 km
≤100 m 7 429≤1 km 2 267≤10 km 1 159>10 km 739
11 594 georeferenced · 2 345 without coordinates
Open the mapobservation + sensor13 939
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy48% within 1 km
≤100 m 604≤1 km 1 810≤10 km 2 251>10 km 400
5 065 georeferenced · 3 171 without coordinates
Open the institutions mapphysical evidence8 236
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions161 of 260 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Philadelphia, US | 492 |
| Madison, US | 458 |
| Chongqing Museumlocation not on record | 432 |
| Olocation not on record | 354 |
| Oulu, FI | 299 |
| St. Paul, US | 292 |
| Québec, CA | 232 |
| Toronto, CA | 201 |
| Moscow State Universitylocation not on record | 192 |
| WTUlocation not on record | 187 |
| Uppsala, SE | 160 |
| Pullman, US | 147 |
| Bronx, US | 147 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 144 |
| Corvallis, US | 143 |
| Bloomington, US | 137 |
| Angwin, US | 129 |
| Wuzhou, CN | 127 |
| Moscow, US | 122 |
| Ann Arbor, US | 119 |
| Université Lavallocation not on record | 117 |
| Arcata, US | 107 |
| Burlington, US | 102 |
| LDlocation not on record | 102 |
| Kuopio, FI | 91 |
| Montréal, CA | 91 |
| Acadia Universitylocation not on record | 88 |
| Green Bay, US | 80 |
| University of New Hampshirelocation not on record | 67 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 64 |
| Saint John, CA | 60 |
| Flagstaff, US | 60 |
| Bangkok, TH | 57 |
| Missoula, US | 57 |
| Williamsburg, US | 56 |
| Saint Louis, US | 52 |
| Trondheim, NO | 51 |
| Denver, US | 51 |
| TROMlocation not on record | 50 |
| Allentown, US | 50 |
| Vancouver, CA | 49 |
| University of Stellenboschlocation not on record | 48 |
| Oskarshamn, SE | 48 |
| Riverside, US | 47 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 47 |
| New Haven, US | 45 |
| Jyväskylä, FI | 44 |
| Boise, US | 44 |
| Irkutsk State Universitylocation not on record | 41 |
| Victoria, CA | 37 |
| Tartu, EE | 37 |
| Zürich, CH | 34 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 32 |
| Claremont, US | 31 |
| Spearfish, US | 29 |
| Bergen, NO | 29 |
| University of Alberta Museumslocation not on record | 29 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 28 |
| Davis, US | 28 |
| SLU Artdatabankenlocation not on record | 28 |
| Albuquerque, US | 27 |
| Zürich, CH | 24 |
| Johnson City, US | 24 |
| Pocatello, US | 23 |
| Bozeman, US | 23 |
| ASUlocation not on record | 21 |
| Lincoln, US | 21 |
| College Park, US | 21 |
| Pittsburg, US | 18 |
| WINlocation not on record | 17 |
| Chapel Hill, US | 17 |
| Chadron, US | 17 |
| University of Lethbridgelocation not on record | 16 |
| Jackson, US | 16 |
| Columbia, US | 16 |
| Morgantown, US | 14 |
| Universität Basel, Herbariumlocation not on record | 14 |
| KMNlocation not on record | 14 |
| TUR-Alocation not on record | 14 |
| Durham, US | 14 |
| Bern, CH | 13 |
| Dekalb, US | 13 |
| McWane Science Centerlocation not on record | 13 |
| Helsinki, FI | 13 |
| Emporia, US | 13 |
| Portland, US | 13 |
| Phoenix, US | 12 |
| Lausanne, CH | 11 |
| Tsukuba, JP | 11 |
| Tacoma, US | 11 |
| CASlocation not on record | 11 |
| Tempe, US | 11 |
| Durango, US | 11 |
| San Luis Obispo, US | 10 |
| USFS/BHSClocation not on record | 10 |
| Paris, FR | 10 |
| Smithsonian Institutionlocation not on record | 10 |
| GB | 10 |
| Beijing, CN | 10 |
| Knoxville, US | 10 |
| Davenport, US | 10 |
| Mount Pleasant, US | 9 |
| Philadelphia, US | 9 |
| Cheney, US | 9 |
| MeiseBGlocation not on record | 9 |
| San Diego, US | 8 |
| Ypsilanti, US | 8 |
| GAlocation not on record | 8 |
| Philadelphia, US | 8 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 8 |
| Ashland, US | 8 |
| Fayetteville, US | 8 |
| DOI/NPS, Greenbelt Parklocation not on record | 8 |
| EL PASO, US | 8 |
| Keene State Universitylocation not on record | 8 |
| Canadian Department of Agriculturelocation not on record | 8 |
| Logan, US | 7 |
| Museum of the Rockieslocation not on record | 7 |
| Turku, FI | 7 |
| Santa Cruz, US | 7 |
| Kirksville, US | 7 |
| Whitewater, US | 6 |
| Whitehorse, CA | 6 |
| Yukon Universitylocation not on record | 6 |
| Staten Island, US | 6 |
| Rovaniemi, FI | 6 |
| Mohonk Preservelocation not on record | 6 |
| Fargo, US | 6 |
| BAYLUlocation not on record | 6 |
| Tallinn, EE | 6 |
| Jena Microbial Resource Collectionlocation not on record | 6 |
| Santa Barbara, US | 5 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 5 |
| Norfolk, US | 5 |
| Fredericton Stock Culture Collectionlocation not on record | 5 |
| KNFHClocation not on record | 5 |
| Provo, US | 5 |
| Tuscaloosa, US | 5 |
| Porvoo, FI | 5 |
| Little Rock, US | 5 |
| Fairfax, US | 5 |
| Washington, US | 5 |
| Chengdu, CN | 5 |
| University of Tennessee at Chattanoogalocation not on record | 5 |
| Chicago, US | 5 |
| Richmond, US | 5 |
| US | 5 |
| nbflocation not on record | 4 |
| Chicago, US | 4 |
| AUAlocation not on record | 4 |
| NMBU:MINAlocation not on record | 4 |
| Caldwell, US | 4 |
| Forssa, FI | 4 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 4 |
| Meguro Parasitological Museumlocation not on record | 4 |
| Oswego, US | 4 |
| STNFlocation not on record | 4 |
| Black Rock Forest Consortiumlocation not on record | 4 |
| Miami, US | 4 |
| University of Guelph, OAC Herbariumlocation not on record | 4 |
| Durango, MX | 4 |
| Lord Fairfax Community Collegelocation not on record | 4 |
| Valdosta State Universitylocation not on record | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 3 |
| Anchorage, US | 3 |
| Research Collection of B. A. Bennettlocation not on record | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| B.A. Bennett Herbariumlocation not on record | 3 |
| New Brunswick, US | 3 |
| China Agricultural Universitylocation not on record | 3 |
| Mississippi State, US | 3 |
| Fort Worth, US | 3 |
| Hudson, US | 3 |
| Durham, US | 3 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 3 |
| Decorah, US | 3 |
| Rocky Mountain Biological Laboratorylocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Trois-Rivières, CA | 3 |
| San Angelo, US | 3 |
| Orem, US | 3 |
| HJAEFlocation not on record | 2 |
| McGill University, Herbariumlocation not on record | 2 |
| University of British Columbia, Herbariumlocation not on record | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Northridge, US | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| Walla Walla, US | 2 |
| Long Beach, US | 2 |
| Memorial University of Newfoundlandlocation not on record | 2 |
| KNFYlocation not on record | 2 |
| LINUlocation not on record | 2 |
| SEFlocation not on record | 2 |
| Wuhan, CN | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| Clemson, US | 2 |
| Hamilton, US | 2 |
| DULlocation not on record | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Truckee, US | 2 |
| USFSlocation not on record | 2 |
| Tromso University Museumlocation not on record | 2 |
| US | 2 |
| IDElocation not on record | 2 |
| San Francisco, US | 2 |
| Tampa, US | 2 |
| Appalachian State Universitylocation not on record | 2 |
| Edmonton, CA | 2 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 2 |
| VALElocation not on record | 2 |
| BRNUlocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| US | 1 |
| Brookings, US | 1 |
| MOBOTlocation not on record | 1 |
| Conway, US | 1 |
| Macomb, US | 1 |
| San Jose, US | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| Guangzhou, CN | 1 |
| Berlin, DE | 1 |
| Kingston, US | 1 |
| Mlocation not on record | 1 |
| Kunming, CN | 1 |
| UFRRJlocation not on record | 1 |
| Chicago, US | 1 |
| Austin, US | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| South Kensington, GB | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| Guilin, CN | 1 |
| Taipei, TW | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| WNNUlocation not on record | 1 |
| Montréal, CA | 1 |
| Chengdu, CN | 1 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| Seropédica, BR | 1 |
| Millersville, US | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Springfield, US | 1 |
| Clarksville, US | 1 |
| Waverly, US | 1 |
| Los Angeles, US | 1 |
| Jefferson City, US | 1 |
| Ciudad de México, MX | 1 |
| Wlocation not on record | 1 |
| Xian, CN | 1 |
| GINRlocation not on record | 1 |
| Conway, US | 1 |
| Baroda, IN | 1 |
| Bend, US | 1 |
| Portland, US | 1 |
| Russellville, US | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
260 institutions · 7 857 of 8 236 vouchered records shown · 378 without an institution code
09Environmental DNA29 detections
Where the DNA of Galium triflorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found29
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 29 detections have coordinates
Open the map3 countries0
Northern temperate mixedwood standDisturbed areas near construction site.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.4 °C 5.80–23.1
Seasonal swing summer↔winter26.2 °C
Max temp (day)23.6 °C 10.9–27.6
Min temp (night)13.6 °C 1.60–19.2
Precipitation88.2 mm/mo 59.0–117
Air humidity58.8 % 56.1–62.8
Moisture balance-44.2 mm/mo -78.3–11.7
Vapour deficit922 Pa 465–1,202
Wind speed3.10 m/s 2.40–4.20
Cloud cover44.7 % 32.6–50.7
CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.