Galium trifidum
speciesAt a glance
Occurrence records13 496
Data sources14
Biological traits98
DNA specimens31
eDNA detections20
Sources14 archives
Databases and archives Galium trifidum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility13 496 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics31 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources98 traits
Occurrence & distributionGBIF13 496 records
Environmental DNA1 datasets · 4 countries20 detections
DNA & barcodingBOLD · NCBI31 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex2n = 24
01Narrative
Przytulia trójdzielna – gatunek rośliny należący do rodziny marzanowatych. Występuje w Ameryce Północnej, Azji. W Polsce gatunek rzadki, prawdopodobnie tylko zawlekany. Spotykany nad jeziorem Kisajno koło Giżycka.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPLEDAGIFTUSDATRY
Size & morphology6
Plant height0.24 m
⚠ sources differ — GIFT: 0.24 m · USDA: 0.244 m · TRY: 0.322 m
Plant height max0.5 m
Plant height min0.05 m
Seed mass0.467 mg
⚠ sources differ — TRY: 0.467 mg · GIFT: 0.599 mg
Seed mass max0.513 mg
Seed mass min0.29 mg
Life cycle & reproduction29
After harvest regrowth rateSlow
Bloom periodEarly Summer
Coppice potentialNo
Dispersal typeanimal
Flower colourwhite
Flower conspicuousNo
Flowering endAug
Flowering startJun
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial
Life spanperennial
Lifespan categoryShort
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Resprout abilityNo
Seed spread rateModerate
Seedling vigorMedium
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment26
Active growth periodSummer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
BloatNone
Climatetemperate
Climberself-supporting
Elevation max2 500 m
Elevation min2 500 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Growth formherb
⚠ sources differ — GIFT: herb · TRY: Vine, Forb/herb
Growth form USDASingle Crown
Habitat GIFTmeadows: wet, rivers
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Root depth min8 in
Shape and orientationDecumbent
Small grainNo
Woodinessnon-woody
Physiology & chemistry19
Anaerobic toleranceHigh
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredYes
Drought toleranceNone
Fertility requirementMedium
Fire resistantNo
Fire toleranceNone
Frost free days min80 days
Moisture useHigh
Nitrogen fixation levelNone
Precipitation max55 in
Precipitation min16 in
Salinity toleranceNone
Seed longevity index0.5
Shade toleranceMedium
Soil pH max8 pH
Soil pH min4.6 pH
Temperature min-38 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound500 000 per lb
ToxicityNone
Veneer productNo
Other traits4
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
05DNA & barcoding31 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galium trifidum has left across the world's sequence archives.
At a glance
DNA specimens31
Marker genes8
GenBank sequences10
eDNA detections20
Countries4
The DNA barcodea real sequence read deposited for this species
CATTGTCGAGTCCTGCAGACGACCGCGCACACGTTAAGAAAACACGCGGGGTGCTCGGCGGACGGGGCGACCCCGGCCGCCGGCCCCCGC …
Galium trifidum voucher V-48311 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL7★rbcLa★trnL-F★ITS2★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Galium trifidum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× diploid · measured
Chromosome records24–442n range24median24mode19records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2418×GoaT · Tree of Sex Database · CCDB · fl-europaea · CCDB · ipcn-api-dl +8
GoaT · Tree of Sex Database — ↗
CCDB · fl-europaea — Puff, 1976
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1980. Chromosome numbers of some Southern Chukotka plant species. Bot. Zhurn. 65 (1): 51–59.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · book-ipcn75-78 — Moore 1975a
CCDB · book-ipcn75-78 — Puff 1976
CCDB · book-northern-plants — Fagerlind 1937.
CCDB · book-ipcn73-74 — SUROVA, T.D. 1973. Chromosome numbers of some species of genera Galium L. and Cruciata Mill. of the North-West European part of the u.s.s-.-R-.---- (in Russian) Bot. zurn. (Moscow & Leningrad) 58: 1819-1824.
CCDB · book-atlas-flowering-plants — 1937
CCDB · Cave1956 — Love & Love b
CCDB · Cave1958 — Jorgensen et al. 1958
CCDB · CromoCat 2015 — Zhukova, P. G. (1980). Chromosome numbers of some southern Chukotka plant species. Bot. Žurn. 65: 51-59.
CCDB · CromoCat 2015 — Zhukova, P. G. (1982). Chromosome numbers of some north-eastern Asia plant species. Bot. Žurn. 67: 360-365.
CCDB · CromoCat 2015 — Puff, C. (1976a). The Galium trifidum group (Galium sect. Aparinoides, Rubiaceae). Canad. J. Bot. 54: 1911-1925.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXV]. Taxon 31(2): 344-360.
TreeOfSex · plant — Goldblatt1979 ↗
2n 441×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Moore, R. J. (1975b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIX]. Taxon 24(4): 502.
n 123×CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · book-ipcn75-78 — Puff 1976
CCDB · CromoCat 2015 — Puff, C. (1976a). The Galium trifidum group (Galium sect. Aparinoides, Rubiaceae). Canad. J. Bot. 54: 1911-1925.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type13 496 records
Wild obs. + sensor8 687
Museum / vouchered4 808
Other1
Origin
Native3
Range
Area of Occupancy AOO41 052 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy77% within 1 km
≤100 m 2 472≤1 km 3 859≤10 km 1 256>10 km 618
8 205 georeferenced · 482 without coordinates
Open the mapobservation + sensor8 687
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy59% within 1 km
≤100 m 478≤1 km 1 012≤10 km 751>10 km 294
2 535 georeferenced · 2 273 without coordinates
Open the institutions mapphysical evidence4 808
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions140 of 221 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Olocation not on record | 300 |
| Uppsala, SE | 295 |
| Moscow State Universitylocation not on record | 292 |
| Oulu, FI | 184 |
| LDlocation not on record | 168 |
| Québec, CA | 156 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 148 |
| WTUlocation not on record | 139 |
| Corvallis, US | 99 |
| Université Lavallocation not on record | 95 |
| Toronto, CA | 92 |
| TROMlocation not on record | 86 |
| Chongqing Museumlocation not on record | 85 |
| Turku, FI | 84 |
| Beijing, CN | 81 |
| Trondheim, NO | 77 |
| Pullman, US | 69 |
| Oskarshamn, SE | 68 |
| SLU Artdatabankenlocation not on record | 67 |
| Garðabær, IS | 61 |
| Acadia Universitylocation not on record | 58 |
| Bronx, US | 57 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 55 |
| Moscow, US | 54 |
| St. Paul, US | 52 |
| Montréal, CA | 49 |
| Green Bay, US | 47 |
| Saint John, CA | 45 |
| Ann Arbor, US | 45 |
| Jyväskylä, FI | 39 |
| Victoria, CA | 38 |
| Kuopio, FI | 38 |
| Durango, MX | 36 |
| Vancouver, CA | 34 |
| University of Alberta Museumslocation not on record | 29 |
| Kandalaksha State Nature Reservelocation not on record | 28 |
| University of New Hampshirelocation not on record | 28 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 27 |
| TUR-Alocation not on record | 26 |
| Madison, US | 25 |
| Burlington, US | 25 |
| Nanjing, CN | 24 |
| Durham, US | 24 |
| Philadelphia, US | 24 |
| Tartu, EE | 23 |
| GJOlocation not on record | 23 |
| Davis, US | 23 |
| WINlocation not on record | 22 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 22 |
| 21 | |
| Lincoln, US | 20 |
| Albuquerque, US | 20 |
| Missoula, US | 18 |
| New Haven, US | 18 |
| Claremont, US | 17 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 17 |
| Flagstaff, US | 17 |
| Kunming, CN | 17 |
| Guangzhou, CN | 14 |
| Provo, US | 14 |
| Santa Barbara, US | 13 |
| Philadelphia, US | 13 |
| University of Stellenboschlocation not on record | 13 |
| Taipei, TW | 12 |
| Chengdu, CN | 12 |
| Boise, US | 12 |
| Riverside, US | 12 |
| Tacoma, US | 12 |
| Chadron, US | 12 |
| Denver, US | 12 |
| Angwin, US | 11 |
| Institute of the biological problems of the North FEB RASlocation not on record | 11 |
| Bozeman, US | 11 |
| Provincia di Livornolocation not on record | 11 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 10 |
| Trois-Rivières, CA | 10 |
| Whitehorse, CA | 10 |
| Bergen, NO | 10 |
| Arcata, US | 10 |
| Yangling, CN | 10 |
| Portland, US | 9 |
| Servico de Microbiologia e Imunologialocation not on record | 9 |
| Taipei, TW | 9 |
| Phoenix, US | 9 |
| DULlocation not on record | 8 |
| Yukon Universitylocation not on record | 8 |
| Orem, US | 8 |
| IWEP FEB RASlocation not on record | 8 |
| Staten Island, US | 8 |
| Helsinki, FI | 8 |
| DOI/NPS, Greenbelt Parklocation not on record | 8 |
| Paris, FR | 8 |
| Porvoo, FI | 7 |
| MeiseBGlocation not on record | 7 |
| Durango, US | 7 |
| Davenport, US | 7 |
| Logan, US | 7 |
| Wuhan, CN | 7 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 6 |
| ASUlocation not on record | 6 |
| Taipei, TW | 6 |
| nbflocation not on record | 6 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 6 |
| Tallinn, EE | 6 |
| Ypsilanti, US | 6 |
| McWane Science Centerlocation not on record | 5 |
| San Luis Obispo, US | 5 |
| GZUlocation not on record | 5 |
| Pocatello, US | 5 |
| Mexico City, MX | 5 |
| US | 5 |
| NMBU:MINAlocation not on record | 5 |
| Mount Pleasant, US | 5 |
| Canadian Department of Agriculturelocation not on record | 4 |
| Bangkok, TH | 4 |
| Montréal, CA | 4 |
| Forssa, FI | 4 |
| Saint Louis, US | 4 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 4 |
| Rovaniemi, FI | 4 |
| San Francisco, US | 4 |
| Chengdu, CN | 4 |
| Chicago, US | 4 |
| Stockholm, SE | 4 |
| KOMlocation not on record | 4 |
| Cheney, US | 4 |
| University of Lethbridgelocation not on record | 4 |
| Wellington, NZ | 4 |
| Austin, US | 3 |
| Grand Junction, US | 3 |
| Brookings, US | 3 |
| B.A. Bennett Herbariumlocation not on record | 3 |
| Bloomington, US | 3 |
| Wuhan, CN | 3 |
| Shanghai, CN | 3 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 3 |
| Kingston, US | 3 |
| Bend, US | 3 |
| Xiamen, CN | 3 |
| Fargo, US | 3 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Philadelphia, US | 3 |
| CASlocation not on record | 3 |
| Columbia, US | 3 |
| Ashland, US | 3 |
| BRNUlocation not on record | 3 |
| Yunnan Universitylocation not on record | 2 |
| TAIElocation not on record | 2 |
| Frankfurt am Main | 2 |
| 黔东南州民族医药研究所标本室location not on record | 2 |
| Bourges, FR | 2 |
| Anchorage, US | 2 |
| Memorial University of Newfoundlandlocation not on record | 2 |
| Bureau of Land Management, Medford District Officelocation not on record | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Uniwersytet Wrocławskilocation not on record | 2 |
| Wlocation not on record | 2 |
| Truckee, US | 2 |
| Rocky Mountain Biological Laboratorylocation not on record | 2 |
| Hangzhou, CN | 2 |
| Mississippi State, US | 2 |
| Millersville, US | 2 |
| Zhejiang Universitylocation not on record | 2 |
| Meguro Parasitological Museumlocation not on record | 2 |
| Mexico City, MX | 2 |
| Weber State Universitylocation not on record | 2 |
| College Park, US | 2 |
| Henderson, US | 2 |
| KR | 2 |
| Portland, US | 2 |
| USFS/BHSClocation not on record | 2 |
| Guilin, CN | 2 |
| Wuzhou, CN | 2 |
| Salzburg, AT | 2 |
| Chapingo, MX | 2 |
| US | 2 |
| Chapel Hill, US | 2 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| San Diego, US | 1 |
| KMNlocation not on record | 1 |
| Bothell, US | 1 |
| Walla Walla, US | 1 |
| Miami, US | 1 |
| Universität Göttingenlocation not on record | 1 |
| Long Beach, US | 1 |
| Tromso University Museumlocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Los Angeles, US | 1 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 1 |
| Nanjing, CN | 1 |
| Clemson, US | 1 |
| Umeå Universitylocation not on record | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Moscow University Herbarium (MW)location not on record | 1 |
| Jackson, US | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Madrid, ES | 1 |
| Dekalb, US | 1 |
| Caldwell, US | 1 |
| Austin, US | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| ENTClocation not on record | 1 |
| Portland, US | 1 |
| Oswego, US | 1 |
| Keene State Universitylocation not on record | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| US | 1 |
| HJAEFlocation not on record | 1 |
| New Brunswick, US | 1 |
| Puebla, MX | 1 |
| USFSlocation not on record | 1 |
| Cambridge, US | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Kew, GB | 1 |
| IPE-CSIClocation not on record | 1 |
| Chicago, US | 1 |
| Zhuzhou, CN | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
221 institutions · 4 532 of 4 808 vouchered records shown · 276 without an institution code
09Environmental DNA20 detections
Where the DNA of Galium trifidum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found20
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 20 detections have coordinates
Open the map4 countries0
Bog near road. Dominated by Ledum groenlandi…Wide pebbly beach surrounding a small pothol…Shallow freshwater marsh behind gravel beach…Roadside ditch.In field near ball field in Bromus inermis, …Low shrub meadow marsh dominated by Salix br…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.2 °C 9.50–16.2
Seasonal swing summer↔winter30.8 °C
Max temp (day)17.9 °C 12.8–21.5
Min temp (night)8.80 °C 5.50–12.4
Precipitation84.4 mm/mo 61.4–122
Air humidity59.8 % 53.6–63.8
Moisture balance-15.3 mm/mo -69.3–33.6
Vapour deficit615 Pa 457–831
Wind speed2.80 m/s 1.90–4.70
Cloud cover45.0 % 36.0–62.8
CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.