Galium tinctorium

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Galium

At a glance

Occurrence records1 764

Data sources12

Biological traits90

DNA specimens10

eDNA detections5

Sources12 archives

Databases and archives Galium tinctorium's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 764 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources90 traits

Occurrence & distributionGBIF1 764 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB499 Mbp

01Narrative

Galium tinctorium là một loài thực vật có hoa trong họ Thiến thảo. Loài này được L. mô tả khoa học đầu tiên năm 1753.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFTUSDA

Size & morphology4

Plant height0.244 m

⚠ sources differ — USDA: 0.244 m · TRY: 0.2 m

Seed mass1.3 mg

Seed mass max1.3 mg

Seed mass min1.3 mg

Life cycle & reproduction25

After harvest regrowth rateSlow

Bloom periodLate Spring

Coppice potentialNo

Flower colourwhite

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endSummer

Growth rate USDAModerate

Life formperennial

Life spanperennial

Lifespan categoryModerate

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Raunkiær life formhemicryptophyte

Resprout abilityNo

Seed spread rateModerate

Seedling vigorMedium

Vegetative spread rateNone

Diet & foraging1

Parasiteindependent

Habitat & environment25

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsYes

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerPorous

Foliage porosity winterPorous

Foliage textureFine

Fruit colourbrown

Growth formherb

Growth form USDASingle Crown

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Mycorrhiza typearbuscular

Root depth min8 in

Shape and orientationDecumbent

Small grainNo

Woodinessnon-woody

Physiology & chemistry18

Anaerobic toleranceHigh

C:N ratioMedium

Caco3 toleranceMedium

Cold stratification requiredYes

Drought toleranceNone

Fertility requirementMedium

Fire resistantNo

Fire toleranceMedium

Frost free days min90 days

Moisture useHigh

Nitrogen fixation levelNone

Precipitation max55 in

Precipitation min32 in

Salinity toleranceNone

Shade toleranceLow

Soil pH max7 pH

Soil pH min4.6 pH

Temperature min-33 °F

Uses & economy13

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityNo Known Source

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound500 000 per lb

ToxicityNone

Veneer productNo

Other traits4

Fall conspicuousNo

Fruit seed abundanceHigh

Fruit seed conspicuousNo

Fruit seed persistenceNo

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galium tinctorium has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes6

GenBank sequences9

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLMK525886.1 ↗549 bp

ACGT

AAAGCAGGTGTTGGATTTAAAGCTGGTGTTAAGGAGTACAAATTAACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATTTTG …

Galium tinctorium ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL6★rbcLaatpF-atpHrpoC1trnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Galium tinctorium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size498 780 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Galium tinctorium0.50 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 244×CCDB · book-ipcn75-78 · CCDB · Cave1962

CCDB · book-ipcn75-78 — Moore 1975a

CCDB · book-ipcn75-78 — Puff 1976

CCDB · Cave1962 — Lewis 1962d

n 123×CCDB · book-ipcn75-78 · CCDB · Cave1962

CCDB · book-ipcn75-78 — Puff 1976

CCDB · Cave1962 — Lewis 1962d

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 764 records

Wild obs. + sensor526

Museum / vouchered1 237

Cultivated / captive1

Range

Area of Occupancy AOO5 836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 304≤1 km 37≤10 km 13>10 km 75

429 georeferenced · 97 without coordinates

Open the mapobservation + sensor526

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 25≤1 km 180≤10 km 304>10 km 53

562 georeferenced · 675 without coordinates

Open the institutions mapphysical evidence1 237

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 47 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Madison, US	247
Tampa, US	135
Ann Arbor, US	105
Bronx, US	77
Montréal, CA	76
Jena Microbial Resource Collectionlocation not on record	60
Austin, US	47
Saint Louis, US	46
St. Paul, US	46
Acadia Universitylocation not on record	42
Miami, US	35
Saint John, CA	32
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	21
Durham, US	18
Wuzhou, CN	13
The State Museum-Preserve "The Kulikovo pole"location not on record	13
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	12
Chicago, US	5
Royal Botanical Gardenslocation not on record	4
Millersville, US	4
McGill University, Herbariumlocation not on record	3
Tempe, US	2
Springfield, US	2
Tall Timbers Research Stationlocation not on record	2
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	2
Museum of the Rockieslocation not on record	2
Long Beach, US	2
Moscow, US	2
UFPRlocation not on record	1
Chicago, US	1
Beijing, CN	1
EL PASO, US	1
Science Museum of Minnesotalocation not on record	1
University of Guelph, OAC Herbariumlocation not on record	1
Meguro Parasitological Museumlocation not on record	1
Columbus State University Herbariumlocation not on record	1
Cambridge, US	1
Istituto Agrario Castelnuovolocation not on record	1
Emporia, US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
GB	1
Peking Universitylocation not on record	1
The Tula Region State Institution of Culture "Tula Museum Association"location not on record	1
LINUlocation not on record	1
Kirksville, US	1
McWane Science Centerlocation not on record	1
Samara National Research Universitylocation not on record	1

47 institutions · 1 074 of 1 237 vouchered records shown · 163 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Galium tinctorium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.8 °C 19.1–22.0

Seasonal swing summer↔winter30.4 °C

Max temp (day)25.5 °C 23.9–27.0

Min temp (night)16.4 °C 14.6–17.9

Precipitation103 mm/mo 78.0–106

Air humidity58.8 % 57.3–59.4

Moisture balance-48.9 mm/mo -93.1–-34.6

Vapour deficit1,027 Pa 923–1,097

Wind speed3.50 m/s 3.30–3.90

Cloud cover47.5 % 38.8–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Galium tinctorium

At a glance

Sources12 archives

Size & morphology4

Life cycle & reproduction25

Diet & foraging1

Habitat & environment25

Physiology & chemistry18

Uses & economy13

Other traits4

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 764 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions25 of 47 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 764 records