Galium parisiense
speciesAt a glance
Occurrence records24 778
Data sources12
Biological traits51
DNA specimens13
eDNA detections8
Sources12 archives
Databases and archives Galium parisiense's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility24 778 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics13 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources51 traits
Occurrence & distributionGBIF24 778 records
Environmental DNA1 datasets · 3 countries8 detections
DNA & barcodingBOLD · NCBI13 specimens
Genome at a glanceCCDB · GoaT2n = 44
01Narrative
Galium parisiense est une espèce de plantes herbacées de la famille des Rubiacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology16
Leaf length max12 mm
Leaf length min2 mm
Leaf mass0.575 mg
Leaf size13.6 mm²
Leaf width max2 mm
Leaf width min0.5 mm
Plant height0.199 m
⚠ sources differ — GIFT: 0.199 m · LEDA: 0.158 m · TRY: 0.22 m
Plant height generative0.38 m
Plant height max0.5 m
Plant height min0.1 m
Seed mass0.159 mg
⚠ sources differ — TRY: 0.159 mg · LEDA: 0.155 mg · GIFT: 0.192 mg
Seed mass max0.2 mg
Seed mass min0.11 mg
Seed volume0.17 mm³
Seed volume max0.17 mm³
Seed volume min0.17 mm³
Life cycle & reproduction16
Deciduousnessevergreen
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: unspecialized
Flower colourgreen
Flower width max1.3 mm
Flower width min0.5 mm
Flowering endAug
Flowering startApr
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Seed number17 606
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 600 m
Elevation min20 m
Epiphyteterrestrial
Fruit fleshinessdry
Growth formherb
Leaf formelliptic
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)199 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)34.53 mm²/mg
⚠ sources differ — TRY: 34.53 mm²/mg · LEDA: 25.2 mm²/mg · GIFT: 25.2 mm²/mg
Other traits4
Diaspore typemericarp
Inflorescencepanicle
Leaf arrangementwhorled
Seeds per fruit101-1000
05DNA & barcoding13 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galium parisiense has left across the world's sequence archives.
At a glance
DNA specimens13
Marker genes6
GenBank sequences7
eDNA detections8
Countries5
The DNA barcodea real sequence read deposited for this species
GTGAATCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCGTTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCTCGTCACCGCC …
Galium parisiense voucher PLT.0334 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★trnL-F★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Galium parisiense carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 44 n = 22
Ploidypolyploid inferred
Chromosome records22–662n range44median44mode38records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4412×CCDB · fl-europaea · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +1
CCDB · fl-europaea — Ehrendorfer, ined.
CCDB · ipcn-api-dl — Ehrendorfer, F. 1982. In D.M. Moore, Flora Europaea Check-list and Chromosome Index.Cambridge Univ. Press. Pp. 168–173, 221–222.
CCDB · ipcn-api-dl — KLIPHUIS, E. 1984. Cytotaxonomic studies on the genus Galium L. Notes on some species occurring in Portugal. Mem. Soc. Brot. 27: 77–87.
CCDB · ipcn-api-dl — Verlaque, R., C. Reynaud & C. Vignal. 1995. Mediterranean chromosome number reports 5 (545-551). Fl. Medit. 5: 350–357.
CCDB · ipcn-api-dl — Valdés, B. & R. Parra. 1997. Números cromosómicos de plantas de Marruecos, 1. Lagascalia 20(1): 161–166.
CCDB · book-ipcn72 — HESS, H.E.' E. LANDOLT", & R. HIRZEL. 1972. Flora der Schweiz. Band 3. Birkhauser Verlag, Basel & Stuttgart.
CCDB · CromoCat 2015 — Ehrendorfer, F. (1982). Flora Europaea Check-list and Chromosome Index. In D.M. Moore. Pp. 168-173, 221-222. Cambridge Univ. Press. Cambridge.
CCDB · CromoCat 2015 — Hess, H. E., Landolt, E. & Hirzel, R. (1972). Flora der Schwiez. Band 3. Birkhäuser Verlag Basel & Stuttgart
CCDB · CromoCat 2015 — Kliphuis, E. (1984a). Cytotaxonomic studies on the genus Galium L. Notes on some species occurring in Portugal. Mem. Soc. Brot. 27: 77-87.
CCDB · CromoCat 2015 — Valdés, B. & R. Parra (1997). Números cromosomáticos de plantas de Marruecos, I. Lagascalia 20(1): 161166.
CCDB · CromoCat 2015 — Verlaque, R., C. Reynaud & C. Vignal. (1995). Reports (545-551). Fl. Medit. 5: 350-357.
2n 6611×CCDB · slov-fl · CCDB · fl-europaea · CCDB · book-ipcn73-74 +1
CCDB · slov-fl — Murín A. & Májovský J., 1983: Karyological study of Slovakian flora IV. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 30: 1-16.
CCDB · slov-fl — Murín A., 2007: [New records in Allium, Artemisia, Astragalus, Ballota, Cardamine, Conringia, Cunninghamia, Fallopia, Ficaria, Galium, Potentilla, Sedum, and Veronica], pp. 79, 111, 119, 122, 158, 199, 217, 258, 267, 269, 285, 466, 467, 534, 606. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · fl-europaea — Ancev, 1974
CCDB · book-ipcn73-74 — ANCEV, M.E. 1974. In IOPB chromosome number reports XLIV. Taxon 23: 373-380.
CCDB · CromoCat 2015 — Ancev, M. E. (1974a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIV]. Taxon 23(2/3): 374-375.
CCDB · CromoCat 2015 — Ancev, M. E. (1974b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVI]. Taxon 23(5/6): 806.
CCDB · CromoCat 2015 — Ancev, M. E. (1978b). Taxonomicno proucvane na rod Galium L.v. Bulgarija V. Evoljucija na cvetnite rastenija i florogenez 1: 107-147.
CCDB · CromoCat 2015 — Ancev, M. E. (1982c). Taxonomic study of genus Galium L. in Bulgaria. II. Karyological and pollen structural investigation. Bulg. Acad. Sci., Phytology 19: 43-68.
CCDB · CromoCat 2015 — Kliphuis, E. (1986). Cytotaxonomic investigations on some species of the genus Galium (Rubiaceae) from the Balkans. Nord. J. Bot. 6: 15-20.
CCDB · CromoCat 2015 — Fagerlind, F. (1934). Beiträge zur Kenntnis der Zytologie der rubiaceen. Hereditas 19: 223-232.
CCDB · CromoCat 2015 — Fagerlind, F. (1937). Embryologische, zytologische und bestäubungs experimentelle Studien in der Familie Rubiaceae nebst Bemerkungen über einige Polyploiditätsprobleme. Acta Horti Berg. 11: 195-470.
2n 229×GoaT · Tree of Sex Database · CCDB · book-ipcn72 · CCDB · CromoCat 2015
GoaT · Tree of Sex Database — ↗
CCDB · book-ipcn72 — SZ.-BORSOS, 0. 1971. Contribution to the knowledge on the chromosome numbers of Phanerogams growing in Hungary and southeastern Europe. II. Acta Bot. Acad. Sci. Hung. 17: 37-46.
CCDB · CromoCat 2015 — Kliphuis, E. (1986). Cytotaxonomic investigations on some species of the genus Galium (Rubiaceae) from the Balkans. Nord. J. Bot. 6: 15-20.
CCDB · CromoCat 2015 — Sz.- Borsos, O. (1971a). Contribution to the knowledge on the chromosome numbers of Phanerogams growing in hungary and Southeastern Europe. Acta Bot. Soc. Bot. Fr. 118: 345-358.
CCDB · CromoCat 2015 — Borsos, O. (1971). Contribution to the knowledge on the chromosome numbers of Phanerogams growing in Hungary and South-eastern Europe. II. Acta Bot. Acad. Sci. Hung. 17: 37-46.
CCDB · CromoCat 2015 — Fagerlind, F. (1934). Beiträge zur Kenntnis der Zytologie der rubiaceen. Hereditas 19: 223-232.
CCDB · CromoCat 2015 — Fagerlind, F. (1937). Embryologische, zytologische und bestäubungs experimentelle Studien in der Familie Rubiaceae nebst Bemerkungen über einige Polyploiditätsprobleme. Acta Horti Berg. 11: 195-470.
CCDB · CromoCat 2015 — Poucques, M. -L., de. (1948). Relations entre caryologie et systématique chez les Rubiales. Bull. Soc. Sci. Nancy 7: 33-39.
CCDB · CromoCat 2015 — Poucques, M. -L., de. (1949a). Recherches caryologiques sur les Rubiales. Rev. Gén. Bot. 56 659:5-27,660:74-96,661:97-1,662:172-188.
2n 624×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Anchev, M. E. 1982a. Taxonomic study of Galium L. in Bulgaria. II. Karyological and pollen structural investigation. Fitologija 19: 43–68. (In Bulgarian).
CCDB · book-ipcn73-74 — ANCEV, M.E. 1974. In IOPB chromosome number reports XLVI. Taxon 23: 801-812.
CCDB · CromoCat 2015 — Ancev, M. E. (1982c). Taxonomic study of genus Galium L. in Bulgaria. II. Karyological and pollen structural investigation. Bulg. Acad. Sci., Phytology 19: 43-68.
CCDB · CromoCat 2015 — Kliphuis, E. (1986). Cytotaxonomic investigations on some species of the genus Galium (Rubiaceae) from the Balkans. Nord. J. Bot. 6: 15-20.
2n 642×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Ancev, M. E. (1982c). Taxonomic study of genus Galium L. in Bulgaria. II. Karyological and pollen structural investigation. Bulg. Acad. Sci., Phytology 19: 43-68.
CCDB · CromoCat 2015 — Kliphuis, E. (1986). Cytotaxonomic investigations on some species of the genus Galium (Rubiaceae) from the Balkans. Nord. J. Bot. 6: 15-20.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type24 778 records
Wild obs. + sensor22 635
Museum / vouchered2 051
Other92
Origin
Native1 815
Introduced50
Range
Area of Occupancy AOO39 740 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy34% within 1 km
≤100 m 2 739≤1 km 3 946≤10 km 12 703>10 km 218
19 606 georeferenced · 3 029 without coordinates
Open the mapobservation + sensor22 635
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy59% within 1 km
≤100 m 108≤1 km 464≤10 km 392>10 km 4
968 georeferenced · 1 083 without coordinates
Open the institutions mapphysical evidence2 051
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions92 of 153 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 243 |
| València, ES | 95 |
| San Diego, US | 88 |
| Riverside, US | 82 |
| BDBClocation not on record | 64 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 63 |
| BClocation not on record | 63 |
| Barcelona, ES | 62 |
| MAlocation not on record | 60 |
| CICYTEXlocation not on record | 58 |
| Claremont, US | 57 |
| Santa Barbara, US | 52 |
| Davis, US | 44 |
| Vitoria, ES | 44 |
| Salamanca, ES | 35 |
| San Luis Obispo, US | 34 |
| Madrid, ES | 29 |
| Córdoba, ES | 27 |
| Phyletisches Museum Jenalocation not on record | 24 |
| Canadian Department of Agriculturelocation not on record | 24 |
| LDlocation not on record | 22 |
| College of the Atlantic, Museumlocation not on record | 21 |
| Provincia di Livornolocation not on record | 20 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 20 |
| Arcata, US | 19 |
| UIBlocation not on record | 18 |
| Angwin, US | 17 |
| Granada, ES | 17 |
| Entomological Society of Latvialocation not on record | 17 |
| MeiseBGlocation not on record | 16 |
| Badajoz, ES | 15 |
| Jackson, US | 15 |
| Wlocation not on record | 14 |
| Alicante, ES | 13 |
| South Kensington, GB | 12 |
| Corvallis, US | 11 |
| US | 10 |
| Bronx, US | 10 |
| Pamplona, ES | 10 |
| GJOlocation not on record | 10 |
| CASlocation not on record | 9 |
| WTUlocation not on record | 9 |
| Jaén, ES | 9 |
| Irvine, US | 8 |
| BRNUlocation not on record | 8 |
| Little Rock, US | 8 |
| Adam Mickiewicz University in Poznańlocation not on record | 7 |
| Lausanne, CH | 7 |
| Paris, FR | 7 |
| Wuzhou, CN | 7 |
| Pocatello, US | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 6 |
| Catalina Island Conservancylocation not on record | 6 |
| CJBGlocation not on record | 6 |
| Ashland, US | 5 |
| Pullman, US | 5 |
| Bourges, FR | 5 |
| Pamplona, ES | 5 |
| Santa Cruz, US | 5 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 4 |
| Mississippi State, US | 4 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 4 |
| ASUlocation not on record | 4 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Long Beach, US | 4 |
| Severin-McDaniel Insect Collectionlocation not on record | 4 |
| DBF-NHMDlocation not on record | 4 |
| STNFlocation not on record | 3 |
| Moscow, US | 3 |
| JBSlocation not on record | 3 |
| Berlin, DE | 3 |
| Moscow State Universitylocation not on record | 3 |
| Henderson, US | 3 |
| Provo, US | 3 |
| Sevilla, ES | 3 |
| San Francisco, US | 3 |
| Los Angeles, US | 3 |
| College Park, US | 3 |
| University of Stellenboschlocation not on record | 3 |
| Fribourg, CH | 3 |
| Zürich, CH | 3 |
| San Jose, US | 3 |
| Bloomington, US | 2 |
| EL PASO, US | 2 |
| BAYLUlocation not on record | 2 |
| BSBIlocation not on record | 2 |
| Regensburgische Botanische Gesellschaftlocation not on record | 2 |
| Victoria, CA | 2 |
| KNFHClocation not on record | 2 |
| Portland, US | 2 |
| Bangkok, TH | 2 |
| Göteborg, SE | 2 |
| University of Southern Mississippilocation not on record | 2 |
| Clemson, US | 2 |
| Logan, US | 2 |
| Chapel Hill, US | 2 |
| KNFYlocation not on record | 2 |
| STUlocation not on record | 2 |
| Frankfurt am Main | 2 |
| Tuscaloosa, US | 2 |
| Fullerton, US | 1 |
| Oskarshamn, SE | 1 |
| Taipei, TW | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Chongqing Museumlocation not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Nijmegen, NL | 1 |
| Columbia, US | 1 |
| Northridge, US | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| Saint Louis, US | 1 |
| Dresden, DE | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 1 |
| EEZA-CSIClocation not on record | 1 |
| Phoenix, US | 1 |
| National Museum Waleslocation not on record | 1 |
| Richmond, US | 1 |
| Portland, US | 1 |
| Universität Göttingenlocation not on record | 1 |
| Due West, US | 1 |
| HJAEFlocation not on record | 1 |
| Monastir, TN | 1 |
| Salzburg, AT | 1 |
| Bend, US | 1 |
| Bern, CH | 1 |
| Burlington, US | 1 |
| OLAlocation not on record | 1 |
| Johnson City, US | 1 |
| Flagstaff, US | 1 |
| Stockholm, SE | 1 |
| Minia, EG | 1 |
| San Angelo, US | 1 |
| Brussel, BE | 1 |
| Norfolk, US | 1 |
| Frauenfeld, CH | 1 |
| IDElocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Fort Worth, US | 1 |
| Fayetteville, US | 1 |
| Palmerston North, NZ | 1 |
| GAlocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Porrentruy, CH | 1 |
| Zürich, CH | 1 |
| Hobart, AU | 1 |
| Brookings, US | 1 |
| CIBIOlocation not on record | 1 |
| Görlitz, DE | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
153 institutions · 1 852 of 2 051 vouchered records shown · 197 without an institution code
09Environmental DNA8 detections
Where the DNA of Galium parisiense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found8
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 8 detections have coordinates
Open the map3 countries0
Lawn weed.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 15.2–18.6
Seasonal swing summer↔winter15.3 °C
Max temp (day)20.5 °C 19.3–25.1
Min temp (night)10.4 °C 9.80–12.3
Precipitation53.6 mm/mo 19.8–70.4
Air humidity57.7 % 54.0–59.0
Moisture balance-60.9 mm/mo -143–-28.0
Vapour deficit804 Pa 733–1,002
Wind speed2.90 m/s 2.80–3.70
Cloud cover41.2 % 29.7–43.9
CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.