Galium palustre
speciesAt a glance
Occurrence records611 800
Data sources14
Biological traits60
DNA specimens48
eDNA detections30
Sources14 archives
Databases and archives Galium palustre's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility611 800 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics48 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources60 traits
Chemical compositionLOTUS3 compounds
Occurrence & distributionGBIF611 800 records
Environmental DNA1 datasets · 9 countries30 detections
DNA & barcodingBOLD · NCBI48 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex1.2 Gbp
01Narrative
Galium palustre, espèce connue en français sous les noms de Gaillet des marais ou Gaillet palustre (Canada) est une plante herbacée vivace de la famille des Rubiaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVPAusTraits
Size & morphology23
Fruit length0.9 mm
⚠ sources differ — AusTraits: 0.9 mm · GIFT: 1 mm
Fruit width1.05 mm
Leaf length8.5 mm
Leaf length max10 mm
Leaf length min5 mm
Leaf mass0.741 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 32.5 mm² · GIFT: 32.5 mm²
Leaf width1.5 mm
⚠ sources differ — AusTraits: 1.5 mm · GIFT: 3 mm
Leaf width max2 mm
Leaf width min1 mm
Plant height0.642 m
⚠ sources differ — GIFT: 0.642 m · LEDA: 0.45 m · TRY: 0.411 m
Plant height generative0.205 m
Plant height max1.2 m
Plant height min0.05 m
Seed length1.84 mm
⚠ sources differ — TRY: 1.84 mm · GIFT: 1.7 mm
Seed length max1.7 mm
Seed length min1.7 mm
Seed mass0.987 mg
⚠ sources differ — TRY: 0.987 mg · LEDA: 0.909 mg · GIFT: 0.907 mg
Seed mass max0.91 mg
Seed mass min0.91 mg
Seed volume1.3 mm³
Seed volume max1.3 mm³
Seed volume min1.3 mm³
Life cycle & reproduction14
Deciduousnesssemi-evergreen
⚠ sources differ — TRY: semi-evergreen · GIFT: evergreen
Dispersal typewater
Flowering endApr
Flowering startMay
Life formperennial
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: annual · LEDA: perennials · GIFT: perennial
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number148
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typemericarp
Growth formherb
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf shapelinear narrowly_elliptical oblanceolate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)195 mg/g
⚠ sources differ — TRY: 195 mg/g · LEDA: 181 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)30.27 mm²/mg
⚠ sources differ — TRY: 30.27 mm²/mg · LEDA: 32.3 mm²/mg · GIFT: 34.14 mm²/mg
Other traits2
Diaspore typegenerative dispersule
Seeds per fruit101-1000
03Chemical composition3 compounds
Compounds documented for Galium palustre across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile3 classes
Gallotannins $ Simple phenolic acids1
Cinnamic acids and derivatives1
Flavonols1
Documented compounds3 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Gallic acid | present | LOTUS | |
| Hyperin | present | LOTUS | |
| trans-Caffeic acid | present | LOTUS |
05DNA & barcoding48 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galium palustre has left across the world's sequence archives.
At a glance
DNA specimens48
Marker genes10
GenBank sequences10
eDNA detections30
Countries11
The DNA barcodea real sequence read deposited for this species
GTGAATCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCATTCGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCTCGTCGCCACC …
Galium palustre voucher PLT.0380 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL8★rbcLa★trnL-F★ITS1★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Galium palustre carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 154 040 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Galium palustre1.15 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidydiploid inferred
Chromosome records24–962n range24median24mode59records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2437×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Tree of Sex Database · CCDB · slov-fl +10
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Tree of Sex Database — ↗
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · brit-fl — Hancock, B.L. New Phytol. 41: 70-78 (1942)
CCDB · brit-fl — Clapham, A.R. British Flowering Plants and Modern Systematic Methods : 72-74 (1948)
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · fl-europaea — Skalinska et al.,
CCDB · poland — Skali?ska M., Piotrowicz M., Soko?owska-Kulczycka A. et al. 1961. Further additions to chromosome numbers of Polish Angiosperms. Acta Soc. Bot. Pol. 30, 463-489.
CCDB · ipcn-api-dl — Donneaux, A. 1981. Contribution a l'etude cytotaxonomique du genre Galium L. s.l. (Rubiaceae) en Belgique et dans les regions voisines. Lejeunia 103: 1–74.
CCDB · ipcn-api-dl — Gregor, T. & R. Hand. 2009. Chromosomenzahlen von Farn- und Samenpflanzen aus Deutschland 4. Kochia 4: 37–46.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Puff, C. 1976. Uber die Galium palustre gruppe (Galium sect. aparinoides, Rubiaceae) in Osterreich. 1. Einige chromosomenzahlen von G. palustre und G. elongatum. Linzer Biol. Beitr. 8: 3–11.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · book-ipcn75-78 — Puff l 976a
CCDB · book-ipcn75-78 — Murin 1976
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.
CCDB · Cave1963 — Gadella & Klip. 1963
CCDB · CromoCat 2015 — Apelgren, K. & Lernstål, R. (1991). Variation in Galium palustre s. lat. in the Baltic land-uplift area Nordic Journal of Botany 10: 565-592
CCDB · CromoCat 2015 — Clapham, A. R. (1949). Taxonomic problems in Galium and Juncus. British flowering plants and modern systematic methods, In Wilmott, A. J. (ed.) 1949: systematic methods, 1949
CCDB · CromoCat 2015 — Fagerlind, F. (1934). Beiträge zur Kenntnis der Zytologie der rubiaceen. Hereditas 19: 223-232.
CCDB · CromoCat 2015 — Fagerlind, F. (1937). Embryologische, zytologische und bestäubungs experimentelle Studien in der Familie Rubiaceae nebst Bemerkungen über einige Polyploiditätsprobleme. Acta Horti Berg. 11: 195-470.
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1963). Chromosome numbers of flowering plants in the Netherlands. Acta Bot. Neerl. 12(2): 195-230.
CCDB · CromoCat 2015 — Hancock, B. L. (1942). Cytological and ecological notes on some species of Galium L. New Phytol. 41: 70-79.
CCDB · CromoCat 2015 — Hindakova, M. (1976). Index of chromosome numbers of Slovakian flora. (Part 5). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1-18.
CCDB · CromoCat 2015 — Kliphuis, E. (1974b). Cytotaxonomic notes on some Galium palustre L. Verh. Kon. Vlaamsche Acad. Wetensch., ser. C 77(4): 408-425.
CCDB · CromoCat 2015 — Kliphuis, E., Heringa, J. & Hogeweg, P. (1986). Cytotaxonomic studies on Galium palustre L. Morphological differentiation of diploids, tetraploids and octoploids. Acta Bot. Neerl. 35: 383-392.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1974b). Cytotaxonomy of Spanish plants. IV.-Dicotyledons: Caesalpinaceae-Asteraceae. Lagascalia 4(2): 153-211.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXV]. Taxon 31(2): 344-360.
CCDB · CromoCat 2015 — Puff, C. (1974). Biosystematik der Formenkreise um Galium palustre L. und G. trifidum L. (Rubiaceae) auf der Nord-und Südhemisphäre. Diss Universität Wien pp. 218
CCDB · CromoCat 2015 — Puff, C. (1976a). The Galium trifidum group (Galium sect. Aparinoides, Rubiaceae). Canad. J. Bot. 54: 1911-1925.
CCDB · CromoCat 2015 — Puff, C. (1976b). Über die Galium palustre gruppe (Galium sect. Aparinoides, Rubiaceae) in Österreich. I. Einige chromosomenzahlen von G. palustre und G. elongatum. Linzer Biol. Beitr. 8: 3-11.
CCDB · CromoCat 2015 — Surova, T. D. (1973). Chromosome numbers of some species of genera Galium L. and Cruciata Mill. of the North-West European part of the U.S.S.R. Bot. Žurn. 58: 1819-1824.
CCDB · CromoCat 2015 — Teppner, H., F. Ehrendorfer & C. Puff. (1976). Karyosystematic notes on the Galium palustre Group. (Rubiaceae). Taxon 25(1): 95-97.
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Donneaux, A. (1981). Contribution à l'étude cytotaxonomique du genre Galium L. s. l. (Rubiaceae) en Belgique et dans les régions voisines Lejeunia 103: 1-75.
CCDB · CromoCat 2015 — Lövkvist, B. & Hultgård, U.-M. (1999). Chromosome numbers in south Swedish vascular plants Opera botanica 137: 1-42
TreeOfSex · plant — Goldblatt1979 ↗
2n 4813×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · fl-europaea +3
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Clapham, A.R. British Flowering Plants and Modern Systematic Methods : 72-74 (1948)
CCDB · fl-europaea — Teppner et al., 1976
CCDB · ipcn-api-dl — Anchev, M. E. 1982a. Taxonomic study of Galium L. in Bulgaria. II. Karyological and pollen structural investigation. Fitologija 19: 43–68. (In Bulgarian).
CCDB · ipcn-api-dl — KLIPHUIS, E. 1984. Cytotaxonomic studies on the genus Galium L. Notes on some species occurring in Portugal. Mem. Soc. Brot. 27: 77–87.
CCDB · book-ipcn73-74 — ANCEV, M.E. 1974. In IOPB chromosome number reports XLIV. Taxon 23: 373-380.
CCDB · CromoCat 2015 — Ancev, M. E. (1974a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIV]. Taxon 23(2/3): 374-375.
CCDB · CromoCat 2015 — Ancev, M. E. (1978b). Taxonomicno proucvane na rod Galium L.v. Bulgarija V. Evoljucija na cvetnite rastenija i florogenez 1: 107-147.
CCDB · CromoCat 2015 — Ancev, M. E. (1982c). Taxonomic study of genus Galium L. in Bulgaria. II. Karyological and pollen structural investigation. Bulg. Acad. Sci., Phytology 19: 43-68.
CCDB · CromoCat 2015 — Kliphuis, E. (1974b). Cytotaxonomic notes on some Galium palustre L. Verh. Kon. Vlaamsche Acad. Wetensch., ser. C 77(4): 408-425.
CCDB · CromoCat 2015 — Kliphuis, E. (1983). Cytotaxonomic notes on some species of the genus Galium L. (Rubiaceae) collected in the North-Western parts of Spain. Lagascalia 11: 229-244.
CCDB · CromoCat 2015 — Kliphuis, E. (1986). Cytotaxonomic investigations on some species of the genus Galium (Rubiaceae) from the Balkans. Nord. J. Bot. 6: 15-20.
CCDB · CromoCat 2015 — Kliphuis, E., Heringa, J. & Hogeweg, P. (1986). Cytotaxonomic studies on Galium palustre L. Morphological differentiation of diploids, tetraploids and octoploids. Acta Bot. Neerl. 35: 383-392.
2n 968×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · CromoCat 2015
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Clapham, A.R. British Flowering Plants and Modern Systematic Methods : 72-74 (1948)
CCDB · CromoCat 2015 — Apelgren, K. & Lernstål, R. (1991). Variation in Galium palustre s. lat. in the Baltic land-uplift area Nordic Journal of Botany 10: 565-592
CCDB · CromoCat 2015 — Kliphuis, E. (1974b). Cytotaxonomic notes on some Galium palustre L. Verh. Kon. Vlaamsche Acad. Wetensch., ser. C 77(4): 408-425.
CCDB · CromoCat 2015 — Kliphuis, E. (1983). Cytotaxonomic notes on some species of the genus Galium L. (Rubiaceae) collected in the North-Western parts of Spain. Lagascalia 11: 229-244.
CCDB · CromoCat 2015 — Kliphuis, E. (1986). Cytotaxonomic investigations on some species of the genus Galium (Rubiaceae) from the Balkans. Nord. J. Bot. 6: 15-20.
CCDB · CromoCat 2015 — Kliphuis, E., Heringa, J. & Hogeweg, P. (1986). Cytotaxonomic studies on Galium palustre L. Morphological differentiation of diploids, tetraploids and octoploids. Acta Bot. Neerl. 35: 383-392.
CCDB · CromoCat 2015 — Surova, T. D. (1973). Chromosome numbers of some species of genera Galium L. and Cruciata Mill. of the North-West European part of the U.S.S.R. Bot. Žurn. 58: 1819-1824.
2n 881×CCDB · poland
CCDB · poland — Skali?ska M., Piotrowicz M., Soko?owska-Kulczycka A. et al. 1961. Further additions to chromosome numbers of Polish Angiosperms. Acta Soc. Bot. Pol. 30, 463-489.
n 126×CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · book-ipcn75-78 — Puff l 976a
CCDB · CromoCat 2015 — Hämet-Ahti, L. & Virrankoski, V. (1970). Chromosome numbers of some vascular plants of north Finland. Ann. Bot. Fenn. 7: 177-181.
CCDB · CromoCat 2015 — Puff, C. (1974). Biosystematik der Formenkreise um Galium palustre L. und G. trifidum L. (Rubiaceae) auf der Nord-und Südhemisphäre. Diss Universität Wien pp. 218
CCDB · CromoCat 2015 — Puff, C. (1976a). The Galium trifidum group (Galium sect. Aparinoides, Rubiaceae). Canad. J. Bot. 54: 1911-1925.
CCDB · CromoCat 2015 — Puff, C. (1976b). Über die Galium palustre gruppe (Galium sect. Aparinoides, Rubiaceae) in Österreich. I. Einige chromosomenzahlen von G. palustre und G. elongatum. Linzer Biol. Beitr. 8: 3-11.
CCDB · CromoCat 2015 — Teppner, H., F. Ehrendorfer & C. Puff. (1976). Karyosystematic notes on the Galium palustre Group. (Rubiaceae). Taxon 25(1): 95-97.
n 241×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Teppner, H., F. Ehrendorfer & C. Puff. (1976). Karyosystematic notes on the Galium palustre Group. (Rubiaceae). Taxon 25(1): 95-97.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type611 800 records
Wild obs. + sensor573 758
Museum / vouchered35 204
Cultivated / captive72
Fossil1
Other2 765
Origin
Native35 213
Introduced43
Range
Area of Occupancy AOO546 384 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy56% within 1 km
≤100 m 141 370≤1 km 113 167≤10 km 198 247>10 km 1 748
454 532 georeferenced · 119 226 without coordinates
Open the mapobservation + sensor573 758
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 3 466≤1 km 9 043≤10 km 16 730>10 km 827
30 066 georeferenced · 5 138 without coordinates
Open the institutions mapphysical evidence35 204
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 72 records without
Open the mapnot free-living72
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions118 of 225 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 22 742 |
| LDlocation not on record | 717 |
| SLU Artdatabankenlocation not on record | 672 |
| PRClocation not on record | 664 |
| Moscow State Universitylocation not on record | 517 |
| Olocation not on record | 457 |
| DBF-NHMDlocation not on record | 434 |
| Uppsala, SE | 415 |
| Provincia di Livornolocation not on record | 366 |
| Trondheim, NO | 344 |
| BFLlocation not on record | 334 |
| Salzburg, AT | 319 |
| BIO-UNIPIlocation not on record | 305 |
| TROMlocation not on record | 281 |
| Bergen, NO | 275 |
| Oulu, FI | 270 |
| Oskarshamn, SE | 239 |
| Tartu, EE | 219 |
| Québec, CA | 187 |
| KMNlocation not on record | 183 |
| MeiseBGlocation not on record | 147 |
| Jyväskylä, FI | 143 |
| Montréal, CA | 141 |
| Adam Mickiewicz University in Poznańlocation not on record | 132 |
| Turku, FI | 130 |
| Acadia Universitylocation not on record | 115 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 106 |
| Université Lavallocation not on record | 104 |
| Burlington, US | 93 |
| Tallinn, EE | 92 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 86 |
| Entomological Society of Latvialocation not on record | 77 |
| Uniwersytet Warszawskilocation not on record | 75 |
| Kuopio, FI | 75 |
| Auckland, NZ | 74 |
| South Kensington, GB | 74 |
| Chongqing Museumlocation not on record | 73 |
| València, ES | 72 |
| Saint John, CA | 67 |
| Philadelphia, US | 65 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 63 |
| University of New Hampshirelocation not on record | 62 |
| Vitoria, ES | 61 |
| Toronto, CA | 60 |
| BRNUlocation not on record | 60 |
| MAlocation not on record | 57 |
| Barcelona, ES | 51 |
| CJBGlocation not on record | 49 |
| CICYTEXlocation not on record | 44 |
| Görlitz, DE | 44 |
| BDBClocation not on record | 44 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 41 |
| Kandalaksha State Nature Reservelocation not on record | 41 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 38 |
| WTUlocation not on record | 37 |
| Mlocation not on record | 34 |
| ISAlocation not on record | 34 |
| Berlin, DE | 30 |
| Bern, CH | 30 |
| New Haven, US | 30 |
| Christchurch, NZ | 29 |
| BClocation not on record | 29 |
| Salamanca, ES | 29 |
| Wlocation not on record | 27 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 24 |
| GJOlocation not on record | 24 |
| Bronx, US | 23 |
| Metsähallituslocation not on record | 23 |
| TUR-Alocation not on record | 23 |
| Ann Arbor, US | 22 |
| Natural History Museum Rotterdamlocation not on record | 21 |
| Wellington, NZ | 21 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 20 |
| Vancouver, CA | 18 |
| Stockholm, SE | 17 |
| Frauenfeld, CH | 16 |
| Hobart, AU | 16 |
| Helsinki, FI | 16 |
| GZUlocation not on record | 16 |
| Rotorua, NZ | 16 |
| Badajoz, ES | 16 |
| Green Bay, US | 15 |
| Museo Achille Folettolocation not on record | 15 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 15 |
| Tula State Universitylocation not on record | 14 |
| Madrid, ES | 14 |
| Pamplona, ES | 14 |
| Porvoo, FI | 13 |
| Uniwersytet Śląski w Katowicachlocation not on record | 13 |
| UGentlocation not on record | 13 |
| Moscow, US | 12 |
| Mount Annan, AU | 11 |
| Museo Entomologico de Leonlocation not on record | 11 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 10 |
| Porrentruy, CH | 10 |
| Keene State Universitylocation not on record | 10 |
| Durham, US | 9 |
| Zürich, CH | 8 |
| Adelaide, AU | 8 |
| Rovaniemi, FI | 8 |
| BSBIlocation not on record | 8 |
| Granada, ES | 7 |
| SZUlocation not on record | 7 |
| Paris, FR | 7 |
| Madison, US | 7 |
| John May Museum of Natural Historylocation not on record | 7 |
| Frankfurt am Main | 7 |
| Wuzhou, CN | 7 |
| Zürich, CH | 6 |
| Winterthur, CH | 6 |
| Alicante, ES | 6 |
| Glarus, CH | 6 |
| Pullman, US | 6 |
| NMBU:MINAlocation not on record | 6 |
| Tilburg, NL | 6 |
| Garðabær, IS | 6 |
| Pamplona, ES | 6 |
| Sion, CH | 5 |
| Podgorica, ME | 5 |
| Lausanne, CH | 5 |
| Dresden, DE | 5 |
| NoColllocation not on record | 5 |
| OLAlocation not on record | 5 |
| Royal Botanic Garden Edinburghlocation not on record | 5 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 4 |
| Córdoba, ES | 4 |
| Göteborg, SE | 4 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 4 |
| PrivatHerblocation not on record | 4 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 4 |
| ZRC-SAZUlocation not on record | 4 |
| Canberra, AU | 4 |
| Bourges, FR | 4 |
| Victoria, CA | 4 |
| Karlsruhe, DE | 4 |
| St. Paul, US | 4 |
| College of the Atlantic, Museumlocation not on record | 4 |
| Chengdu, CN | 4 |
| Whitehorse, CA | 4 |
| National Museum Waleslocation not on record | 4 |
| Hamilton, US | 4 |
| Kew, GB | 3 |
| Royal Botanical Gardenslocation not on record | 3 |
| Trois-Rivières, CA | 3 |
| nbflocation not on record | 3 |
| Nijmegen, NL | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Saint Louis, US | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 3 |
| Kensington, AU | 3 |
| Forssa, FI | 2 |
| Kunming, CN | 2 |
| Namur, BE | 2 |
| Coimbra, PT | 2 |
| Staten Island, US | 2 |
| Finnish Museum of Natural Historylocation not on record | 2 |
| Beijing, CN | 2 |
| JBSlocation not on record | 2 |
| Whitewater, US | 2 |
| Samara National Research Universitylocation not on record | 2 |
| Flagstaff, US | 2 |
| Musée des Confluenceslocation not on record | 2 |
| Miami, US | 2 |
| Davenport, US | 2 |
| Brisbane, AU | 2 |
| Boise, US | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Oswego, US | 2 |
| University of Alberta Museumslocation not on record | 2 |
| UFRRJlocation not on record | 2 |
| University of Stellenboschlocation not on record | 2 |
| Seropédica, BR | 2 |
| Xiamen, CN | 2 |
| UIBlocation not on record | 2 |
| CIBIOlocation not on record | 1 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| US | 1 |
| Fulda, DE | 1 |
| Herb. BBGlocation not on record | 1 |
| Chicago, US | 1 |
| Riverside, US | 1 |
| Dekalb, US | 1 |
| Washington, US | 1 |
| STUlocation not on record | 1 |
| Salvador, BR | 1 |
| Uniwersytet w Białymstokulocation not on record | 1 |
| Pocatello, US | 1 |
| ULBF-AGRlocation not on record | 1 |
| Portland, US | 1 |
| Gijón, ES | 1 |
| Chengdu, CN | 1 |
| Jaén, ES | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Columbia, US | 1 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Fundación Miguel Lillolocation not on record | 1 |
| San Isidro, AR | 1 |
| Denver, US | 1 |
| WINlocation not on record | 1 |
| San Angelo, US | 1 |
| Kingston, US | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Sevilla, ES | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Centre for Biodiversity Genomicslocation not on record | 1 |
| Ulocation not on record | 1 |
| Memorial University of Newfoundlandlocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| ENTClocation not on record | 1 |
| Hangzhou, CN | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| Millersville, US | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Yugra State University Biological Collectionlocation not on record | 1 |
| 1 |
225 institutions · 33 804 of 35 204 vouchered records shown · 1 240 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA30 detections
Where the DNA of Galium palustre was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found30
Studies independent surveys1
Countries9
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 30 detections have coordinates
Open the map9 countries0
in marsh with Juncus sppin boggy graslandMarshesin marsh with Gallium borealeYoung Acer rubrum, Populus tremuloides ripar…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.0 °C 12.4–18.6
Seasonal swing summer↔winter14.8 °C
Max temp (day)18.2 °C 14.9–23.6
Min temp (night)10.7 °C 8.40–14.1
Precipitation72.6 mm/mo 57.6–104
Air humidity61.3 % 56.8–64.4
Moisture balance-41.3 mm/mo -65.2–60.1
Vapour deficit667 Pa 521–914
Wind speed3.60 m/s 2.70–4.60
Cloud cover47.1 % 39.5–54.0
CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.