Galium oreganum

Britton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Galium

At a glance

Occurrence records410

Data sources9

Biological traits88

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Galium oreganum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility410 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources88 traits

Occurrence & distributionGBIF410 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · TreeOfSex2n = 22

01Narrative

Galium oreganum (Oregon bedstraw) is a plant species in the family Rubiaceae.Nathaniel Lord Britton. 1894. Bulletin of the Torrey Botanical Club 21(1): 31 It is native to British Columbia, Washington, Oregon, and northern California (Siskiyou and Del Norte Counties).Kew World Checklist of Selected Plant FamiliesBiota of North America ProgramHitchcock, C. H., A.J. Cronquist, F. M. Ownbey & J. W. Thompson. 1984. Ericaceae through Campanulaceae. Part IV: 1–510. In C. L. Hitchcock Vascular Plants of the Pacific Northwest. University of Washington Press, Seattle.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology2

Plant height0.3 m

Seed mass0.599 mg

Life cycle & reproduction23

After harvest regrowth rateRapid

Bloom periodMid Summer

Coppice potentialNo

Flower colouryellow

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endFall

Growth rate USDARapid

Life spanperennial

Lifespan categoryShort

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateRapid

Seedling vigorHigh

Vegetative spread rateSlow

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsNo

Adapted to fine textured soilsYes

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerPorous

Foliage porosity winterPorous

Foliage textureFine

Fruit colourbrown

Growth formherb

Growth form USDARhizomatous

Hedge toleranceHigh

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min6 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry19

Anaerobic toleranceMedium

C:N ratioLow

Caco3 toleranceNone

Cold stratification requiredYes

Drought toleranceNone

Fertility requirementMedium

Fire resistantYes

Fire toleranceMedium

Frost free days min140 days

Moisture useLow

Nitrogen fixation levelNone

Precipitation max14 in

Precipitation min8 in

Protein potentialMedium

Salinity toleranceNone

Shade toleranceLow

Soil pH max7.5 pH

Soil pH min6 pH

Temperature min-13 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityNo Known Source

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable browse animalLow

Palatable graze animalLow

Palatable humanYes

Post productNo

Pulpwood productNo

Seeds per pound756 000 per lb

ToxicityNone

Veneer productNo

Other traits4

Fall conspicuousNo

Fruit seed abundanceMedium

Fruit seed conspicuousNo

Fruit seed persistenceNo

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galium oreganum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMG954021.1 ↗1 264 bpUSA

ACGT

GAGTACAAATTAACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATTTTGGCAGCATTCCGAGTAACTCCTCAACCGGGAGTT …

Galium oreganum isolate Valarie Soza 1761 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB · TreeOfSex

The complete instruction manual Galium oreganum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 112×CCDB · ipcn-api-dl · TreeOfSex · plant

CCDB · ipcn-api-dl — Chambers, K. L., D. Green, S. Potampa & L. McMahan. 1998. IOPB chromosome data 13. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 29: 18–22.

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type410 records

Wild obs. + sensor188

Museum / vouchered222

Range

Area of Occupancy AOO1 172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 101≤1 km 14≤10 km 9>10 km 3

127 georeferenced · 61 without coordinates

Open the mapobservation + sensor188

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 8≤1 km 75≤10 km 66>10 km 15

164 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence222

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Corvallis, US	76
WTUlocation not on record	48
Pullman, US	31
DOI/NPS, Mount Rainier National Parklocation not on record	13
Angwin, US	5
Portland, US	4
Tacoma, US	4
Portland, US	4
Ashland, US	3
HJAEFlocation not on record	3
Wuzhou, CN	3
Arcata, US	3
Boise, US	2
Bend, US	2
Bronx, US	2
Tempe, US	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
Moscow, US	2
San Francisco, US	1
US	1
San Angelo, US	1
Claremont, US	1
Saint Louis, US	1
Bloomington, US	1
ASUlocation not on record	1
Bangkok, TH	1
DOI/NPS, Greenbelt Parklocation not on record	1

27 institutions · 218 of 222 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)