Galium mollugo

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Galium

At a glance

Occurrence records368 591

Data sources16

Biological traits62

DNA specimens61

eDNA detections36

Sources16 archives

Databases and archives Galium mollugo's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility368 591 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics61 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources62 traits

Chemical compositionLOTUS · NPASS123 compounds

Occurrence & distributionGBIF368 591 records

Environmental DNA1 datasets · 8 countries36 detections

DNA & barcodingBOLD · NCBI61 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex1.4 Gbp

01Narrative

Galium mollugo, common name hedge bedstraw or false baby's breath, is a herbaceous perennial plant of the family Rubiaceae. It shares the name hedge bedstraw with the related European species, Galium album.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYAusTraitsWCVP

Size & morphology20

Fruit length0.65 mm

⚠ sources differ — AusTraits: 0.65 mm · GIFT: 1 mm

Fruit width2 mm

Leaf length19 mm

Leaf length max12 mm

Leaf mass2.32 mg

Leaf size460 mm²

⚠ sources differ — TRY: 460 mm² · LEDA: 80.5 mm² · GIFT: 80.5 mm²

Leaf width4 mm

⚠ sources differ — AusTraits: 4 mm · GIFT: 3 mm

Leaf width max3 mm

Leaf width min3 mm

Plant height0.7 m

⚠ sources differ — GIFT: 0.7 m · LEDA: 0.5 m · TRY: 0.22 m

Plant height generative0.242 m

Plant height max1.5 m

Plant height min0.2 m

Seed length1.22 mm

Seed mass0.651 mg

⚠ sources differ — TRY: 0.651 mg · LEDA: 0.709 mg · GIFT: 0.706 mg

Seed mass max0.71 mg

Seed mass min0.7 mg

Seed volume0.82 mm³

Seed volume max0.82 mm³

Seed volume min0.82 mm³

Life cycle & reproduction14

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Dispersal typeanimal

⚠ sources differ — LEDA: endozoochor · GIFT: unspecialized

Flowering endSep

Flowering startMay

Life formperennial

Life spanperennial

⚠ sources differ — TRY: perennial · AusTraits: perennial · LEDA: poly-annuals 5-50 years (medium-lived perennials) · GIFT: perennial

Lifespan years9 years

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Reproduction asexualabsent

Seed number20 000

Self fertilizationpresent

Sex typehermaphrodite

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment14

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formherb

Habitat GIFTcrop fields, forest, lakes, meadows, rivers, roadsides

Leaf compoundnesssimple

Leaf shapeelliptical linear oblanceolate oblong obovate

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry10

Leaf C:N ratio17.56 g/g

Leaf c438 mg/g

Leaf dry-matter content (LDMC)242 mg/g

⚠ sources differ — TRY: 242 mg/g · LEDA: 166 mg/g

Leaf n22.74 mg/g

Leaf p3.68 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Seed longevity index0

Specific leaf area (SLA)22.13 mm²/mg

⚠ sources differ — TRY: 22.13 mm²/mg · LEDA: 26.7 mm²/mg · GIFT: 26.88 mm²/mg

Wood density166 mg/cm³

Other traits2

Diaspore typegenerative dispersule

Seeds per fruit>1000

03Chemical composition123 compounds

Compounds documented for Galium mollugo across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Iridoids monoterpenoids20

Chalcones9

Flavonols8

Wax monoesters7

Cinnamic acids and derivatives6

Documented compounds123 total

Compound	Amount	Source
(1S,4aR,7R,7aR)-7-hydroxy-4-methoxycarbonyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4a,7a-dihydro-1H-cyclopenta[c]pyran-7-carboxylic acid	present	LOTUS
(1S,4aR,7R,7aS)-7-hydroxy-4-methoxycarbonyl-1-[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4a,7a-dihydro-1H-cyclopenta[c]pyran-7-carboxylic acid	present	LOTUS
(1S,4aS,7S,7aS)-7-hydroxy-7-(hydroxymethyl)-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4a,7a-dihydro-1H-cyclopenta[c]pyran-4-carboxylic acid	present	LOTUS
(2e)-7-Phenylhepta-2-en-4,6-diyn-1-yl acetate	present	NPASS
(2R)-7-phenylhepta-4,6-diyne-1,2-diol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(2R)-1-hydroxytrideca-5,7,9,11-tetrayn-2-yl]oxyoxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(E,2R)-1-hydroxytridec-5-en-7,9,11-triyn-2-yl]oxyoxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(E,3R)-1-hydroxytetradec-6-en-8,10,12-triyn-3-yl]oxyoxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(E,3S)-3-hydroxytetradec-6-en-8,10,12-triynoxy]oxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[[5-(2-phenylethynyl)thiophen-2-yl]methoxy]oxane-3,4,5-triol	present	NPASS

05DNA & barcoding61 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galium mollugo has left across the world's sequence archives.

At a glance

DNA specimens61

Marker genes9

GenBank sequences10

eDNA detections36

Countries9

The DNA barcodea real sequence read deposited for this species

ITSPQ138126.1 ↗323 bpPortugal · 2018

ACGT

GTGAATCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCTTCCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCTCGTCACCACC …

Galium mollugo subsp. mollugo voucher PLT.0005 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matKrbcL4rbcLatrnL-FITS6ITS2atpF-atpHrpoC1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Galium mollugo carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 404 727 346 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Galium mollugo1.4 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–882n range22median22mode83records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2245×GoaT · Tree of Sex Database · CCDB · slov-fl · CCDB · iber-fl +8

GoaT · Tree of Sex Database — ↗

CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.

CCDB · slov-fl — Michalková E., 1991: Výsledky štúdia počtov chromozómov Galium mollugo agg. na Slovensku. - Biologia (Bratislava) 46/9: 799-810.

CCDB · slov-fl — Sýkorová M., 2007: [New records in Galium], pp. 285. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.

CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 556-591. Pastor Daz, J. & al.Lagascalia15(2): 269-282(1990).

CCDB · fl-europaea — Krendl, 1967

CCDB · poland — Piotrowicz M. 1958. Karyological studies in some species of the genus Galium L. Acta Biol. Cracov. Ser. Bot. 1, 159-169.

CCDB · ipcn-api-dl — KLIPHUIS, E. 1983. Cytotaxonomic notes on some species of the genus Galium L. (Rubiaceae) collected in the North-western parts of Spain. Lagascalia 11: 229–244.

CCDB · ipcn-api-dl — Pastor, J., J. C. Diosdado, C. S. Bárbara, J. Vique & E. Pérez. 1990. Números cromosómicos para la flora Española. 556--591. Lagascalia 15: 269–282.

CCDB · ipcn-api-dl — Michalková, E. 1991. Results of the study of the chromosome numbers of Galium mollugo agg. in Slovakia. Biologia (Bratislava) 46: 799–810.

CCDB · ipcn-api-dl — Natali, A. & D. Jeanmonod. 1992. Sur la prĕsence du Galium mollugo L. s. str. en Corse. Candollea 47(2): 311–318.

CCDB · ipcn-api-dl — Gregor, T. & R. Hand. 2008. Chromosomenzahlen von Farn- und Samenpflanzen aus Deutschland 3. Kochia 3: 55–60.

CCDB · book-ipcn75-78 — Labadie 1976a

CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.

CCDB · Cave1962 — Kliphuis 1962b

CCDB · Cave1963 — Sorsa 1963c

CCDB · CromoCat 2015 — Fagerlind, F. (1937). Embryologische, zytologische und bestäubungs experimentelle Studien in der Familie Rubiaceae nebst Bemerkungen über einige Polyploiditätsprobleme. Acta Horti Berg. 11: 195-470.

CCDB · CromoCat 2015 — Kliphuis, E. (1983). Cytotaxonomic notes on some species of the genus Galium L. (Rubiaceae) collected in the North-Western parts of Spain. Lagascalia 11: 229-244.

CCDB · CromoCat 2015 — Krendl, F. (1966). Zur Phytologie der Gattung Galium, VIII. Cytotaxonomie der Galium mollugo-Gruppe in Mittleleuropa. Diss. Universität Wien pp. 95+IV

CCDB · CromoCat 2015 — Krendl, F. (1967). Cytotaxonomie der Galium mollugo Gruppe in Mitteleuropa. (Zur phylogenie der Gattung Galium, VIII.). Österr. Bot. Z. 114: 508-549.

CCDB · CromoCat 2015 — Májovsky, J. (1974a). Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 22: 1-20.

CCDB · CromoCat 2015 — Michalková, E. (1991). Results of the study of the chromosome numbers of Galium mollugo agg. in Slovakia Biologia 46: 799-810

CCDB · CromoCat 2015 — Natali, A. & D. Jeanmonod. (1992). Sur la presence du Galium mollugo L. s. str. en Corse Candollea 47(2): 311-318

CCDB · CromoCat 2015 — Pastor Díaz, J., J. C. Diosdado, C. Santa Bárbara, J. Vioque & E. Pérez. (1990). Números cromosómicos para la flora española, 556-591. Lagascalia 15(2): 269-282.

CCDB · CromoCat 2015 — Piotrowicz, M. (1959). Karyological studies in some species of the genus Galium L. Acta Biol. Cracov., Ser. Bot. 1: 159-169.

2n 4435×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · brit-fl +8

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.

CCDB · brit-fl — Wentworth, J.E., Bailey, J.P., Gornall, R.J. Watsonia 18: 415-418 (1991)

CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)

CCDB · brit-fl — Montgomery, L., Khalaf, M.K., Bailey, J.P., Gornall, R.J. Watsonia 21: 365-368 (1997)

CCDB · poland — Piotrowicz M. 1958. Karyological studies in some species of the genus Galium L. Acta Biol. Cracov. Ser. Bot. 1, 159-169.

CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1985. Kariologicheskaja kharakteristika nekotorykh vidov poleznykh rastenij flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 6: 3–8.

CCDB · ipcn-api-dl — Lippert, W. & G. R. Heubl. 1989. Chromosomenzahlen von Pflanzen aus Bayern und angrenzenden Gebieten: [Teil 2]. Ber. Bayer. Bot. Ges. 60: 73–83.

CCDB · ipcn-api-dl — Dmitrieva, S. A. 1986. Chisla khromosom nekotorych vidov rastenij Berezinskogo Biosfernogo Zapovednika. Zapov. Belorussii Issl. 10: 24–28.

CCDB · ipcn-api-dl — Wentworth, J. E., J. P. Bailey & R. J. Gornall. 1991. Contributions to a cytological catalogue of the British and Irish flora, 1. Watsonia 18: 415–417.

CCDB · ipcn-api-dl — Hollingsworth, P. M., R. J. Gornall & J. P. Bailey. 1992. Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134–137.

CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.

CCDB · ipcn-api-dl — Donneaux, A. 1981. Contribution a l'etude cytotaxonomique du genre Galium L. s.l. (Rubiaceae) en Belgique et dans les regions voisines. Lejeunia 103: 1–74.

CCDB · book-ipcn75-78 — Ferakova 1974

CCDB · book-ipcn73-74 — SUROVA, T.D. 1973. Chromosome numbers of some species of genera Galium L. and Cruciata Mill. of the North-West European part of the u.s.s-.-R-.---- (in Russian) Bot. zurn. (Moscow & Leningrad) 58: 1819-1824.

CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.

CCDB · Cave1962 — Kliphuis 1962b

CCDB · Cave1963 — Gadella & Klip, 1963

CCDB · CromoCat 2015 — Albers, F. & Pröbsting, W. (1998). In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart

CCDB · CromoCat 2015 — Dmitrieva, S. A. & Parfenov, V. I. (1985). Kariologicheskaja kharakteristika nekotorykh vidov poleznykh rastenij flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk (Minsk) 6: 3-8.

CCDB · CromoCat 2015 — Dmitrieva, S. A. (1986b). Chisla khromosom nekotorych vidov rastenij Berezinskogo Biosfernogo Zapovednika. Zapovedniki Belorussii Issledovaniia 10: 24-28.

CCDB · CromoCat 2015 — Donneaux, A. (1981). Contribution à l'étude cytotaxonomique du genre Galium L. s. l. (Rubiaceae) en Belgique et dans les régions voisines Lejeunia 103: 1-75.

CCDB · CromoCat 2015 — Fagerlind, F. (1937). Embryologische, zytologische und bestäubungs experimentelle Studien in der Familie Rubiaceae nebst Bemerkungen über einige Polyploiditätsprobleme. Acta Horti Berg. 11: 195-470.

CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1963). Chromosome numbers of flowering plants in the Netherlands. Acta Bot. Neerl. 12(2): 195-230.

CCDB · CromoCat 2015 — Hollingsworth, P. M., Gornall, R. J. & Bailey, J. P. (1992). Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134-137.

CCDB · CromoCat 2015 — Lippert, W. & Heubl, G.R. (1989). Chromosomenzahlen von Pflanzen aus Bayern und angrenzenden Gebieten: [Teil 2]. Ber. Bayer. Bot. Ges. 60: 73-83.

CCDB · CromoCat 2015 — Piotrowicz, M. (1959). Karyological studies in some species of the genus Galium L. Acta Biol. Cracov., Ser. Bot. 1: 159-169.

CCDB · CromoCat 2015 — Pólya, L. (1949). Chromosome numbers of some Hungarian plants. Acta Geobot. Hung. 6: 124-137.

CCDB · CromoCat 2015 — Surova, T. D. (1973). Chromosome numbers of some species of genera Galium L. and Cruciata Mill. of the North-West European part of the U.S.S.R. Bot. Žurn. 58: 1819-1824.

CCDB · CromoCat 2015 — Wentworth, J. E., J. P. Bailey & R. J. Gornall. (1991). Contributions to a cytological catalogue of the British and Irish flora, 1. Watsonia 18: 415-417.

CCDB · CromoCat 2015 — Fagerlind, F. (1934). Beiträge zur Kenntnis der Zytologie der rubiaceen. Hereditas 19: 223-232.

CCDB · CromoCat 2015 — Hindakova, M. (1974). Index of chromosome numbers of Slovakian flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1-23.

CCDB · CromoCat 2015 — Homeyer, H. (1932). Zur Zytologie der Rubiaceen. (Vorl. Mitt.). Planta 18: 640.

CCDB · CromoCat 2015 — Homeyer, H. (1936). Beiträge zur Kenntnis der Zytologie und Systematik der Rubiaceen. Bot. Jahrb. Syst. 67: 237-263.

TreeOfSex · plant — Goldblatt1979 ↗

2n 381×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Tischler, G. (1950). Die chromosomenzhalen der GefäBpflanzen Mitteleuropas. s'-Gravenhage: W. Junk. 263

2n 451×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Fagerlind, F. (1937). Embryologische, zytologische und bestäubungs experimentelle Studien in der Familie Rubiaceae nebst Bemerkungen über einige Polyploiditätsprobleme. Acta Horti Berg. 11: 195-470.

2n 661×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Fagerlind, F. (1937). Embryologische, zytologische und bestäubungs experimentelle Studien in der Familie Rubiaceae nebst Bemerkungen über einige Polyploiditätsprobleme. Acta Horti Berg. 11: 195-470.

2n 881×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Piotrowicz, M. (1959). Karyological studies in some species of the genus Galium L. Acta Biol. Cracov., Ser. Bot. 1: 159-169.

n 223×CCDB · book-ipcn73-74 · CCDB · CromoCat 2015

CCDB · book-ipcn73-74 — LAANE, M.M. 1971. Chromosome number in Norwegian vascular plant species: 6. (in Norwegian). Blyttia 29: 229-234.

CCDB · CromoCat 2015 — Laane, M. M. (1971). Chromosome numbers in Norwegian vascular plant species 6. Blyttia 29: 229-234.

CCDB · CromoCat 2015 — Mulligan, G. A. (1967). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XIV]. Taxon 16(6): 562-571.

n 112×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Krendl, F. (1966). Zur Phytologie der Gattung Galium, VIII. Cytotaxonomie der Galium mollugo-Gruppe in Mittleleuropa. Diss. Universität Wien pp. 95+IV

CCDB · CromoCat 2015 — Krendl, F. (1967). Cytotaxonomie der Galium mollugo Gruppe in Mitteleuropa. (Zur phylogenie der Gattung Galium, VIII.). Österr. Bot. Z. 114: 508-549.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

07Deep time~9.98 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin9.98 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

How it livedPBDB

Dietphotoautotroph

08Occurrence & distribution

Record type368 591 records

Wild obs. + sensor338 626

Museum / vouchered26 566

Cultivated / captive1 467

Fossil2

Other1 930

Origin

Native111

Introduced42

Range

Area of Occupancy AOO355 284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy35% within 1 km

≤100 m 56 721≤1 km 35 192≤10 km 167 055>10 km 3 572

262 540 georeferenced · 76 086 without coordinates

Open the mapobservation + sensor338 626

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 2 054≤1 km 5 415≤10 km 14 561>10 km 563

22 593 georeferenced · 3 973 without coordinates

Open the institutions mapphysical evidence26 566

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy4% within 1 km

≤1 km 1>10 km 24

25 georeferenced · 1 442 without coordinates

Open the mapnot free-living1 467

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions129 of 245 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	18 592
Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record	1 020
Moscow State Universitylocation not on record	635
BIO-UNIPIlocation not on record	388
Uppsala, SE	329
PRClocation not on record	245
Philadelphia, US	166
Adam Mickiewicz University in Poznańlocation not on record	165
Bergen, NO	148
Chongqing Museumlocation not on record	134
Uniwersytet Warszawskilocation not on record	128
UniKSlocation not on record	125
Tartu, EE	123
Provincia di Livornolocation not on record	121
Québec, CA	110
SLU Artdatabankenlocation not on record	103
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	94
Mlocation not on record	83
BFLlocation not on record	80
Karlsruhe, DE	77
MeiseBGlocation not on record	77
Berlin, DE	69
LDlocation not on record	69
Entomological Society of Latvialocation not on record	68
Bronx, US	66
Burlington, US	62
Universidad del Pais Vasco (UPV/EHU)location not on record	60
Bern, CH	56
New Haven, US	56
Allentown, US	55
GJOlocation not on record	53
TROMlocation not on record	48
Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record	42
BRNUlocation not on record	42
Görlitz, DE	38
Olocation not on record	37
Université Lavallocation not on record	36
KIRMlocation not on record	33
Montréal, CA	30
Toronto, CA	30
Barcelona, ES	29
Oskarshamn, SE	28
University of New Hampshirelocation not on record	27
Saint John, CA	27
Tula State Universitylocation not on record	26
BDBClocation not on record	25
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	25
Acadia Universitylocation not on record	23
Tallinn, EE	23
Green Bay, US	22
Salzburg, AT	22
Wlocation not on record	21
MAlocation not on record	21
Garðabær, IS	21
KMNlocation not on record	19
Zürich, CH	18
Zürich, CH	18
Natural History Museum Rotterdamlocation not on record	17
Institut und Museum fuer Geologie und Palaeontologielocation not on record	17
Bloomington, US	17
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	17
Corvallis, US	17
ISAlocation not on record	16
Uniwersytet Śląski w Katowicachlocation not on record	15
Wuzhou, CN	15
Madison, US	15
South Kensington, GB	15
BClocation not on record	15
College Park, US	14
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	14
Salamanca, ES	13
Auckland, NZ	13
Trondheim, NO	13
Kandalaksha State Nature Reservelocation not on record	12
Uniwersytet Opolskilocation not on record	11
Vitoria, ES	11
Stockholm, SE	11
Dekalb, US	11
Porrentruy, CH	11
Glarus, CH	11
Hudson, US	10
WTUlocation not on record	9
PrivatHerblocation not on record	9
St. Paul, US	8
Kushiro City Museumlocation not on record	8
Phyletisches Museum Jenalocation not on record	8
Paris, FR	8
Mohonk Preservelocation not on record	8
DBF-NHMDlocation not on record	8
Vancouver, CA	8
The Tula Region State Institution of Culture "Tula Museum Association"location not on record	8
GZUlocation not on record	8
CICYTEXlocation not on record	7
Morgantown, US	7
Museum of the Rockieslocation not on record	7
Millersville, US	7
València, ES	7
Staten Island, US	7
University of Stellenboschlocation not on record	6
Philadelphia, US	6
Prioksko-Terrasnyi Biosphere Reservelocation not on record	6
Pamplona, ES	6
Madrid, ES	6
	6
Tilburg, NL	6
CJBGlocation not on record	6
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record	6
NMBU:MINAlocation not on record	6
Williamsburg, US	6
Wellington, NZ	5
Canadian Department of Agriculturelocation not on record	5
Durham, US	5
BAYLUlocation not on record	5
Keene State Universitylocation not on record	5
Dhaka, BD	5
Lausanne, CH	5
The State Museum-Preserve "The Kulikovo pole"location not on record	5
Jyväskylä, FI	5
Pamplona, ES	4
Whitehorse, CA	4
Frankfurt am Main	4
SWlocation not on record	4
Coimbra, PT	4
Bangkok, TH	4
University of Guelph, OAC Herbariumlocation not on record	4
Oswego, US	4
nbflocation not on record	4
Conservatoire botanique national du Bassin parisienlocation not on record	4
Bourges, FR	4
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	4
Naturalis Biodiversity Centerlocation not on record	4
College of the Atlantic, Museumlocation not on record	4
Monastir, TN	4
Christchurch, NZ	4
Institute of the biological problems of the North FEB RASlocation not on record	4
Pullman, US	3
JBSlocation not on record	3
National Museum Waleslocation not on record	3
Nijmegen, NL	3
New Brunswick, US	3
Washington, US	3
UGentlocation not on record	3
DASSHlocation not on record	3
EL PASO, US	3
Dresden, DE	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	3
Universität Göttingenlocation not on record	3
Hobart, AU	3
Hamilton, US	3
Sion, CH	3
DULlocation not on record	3
LfUlocation not on record	3
Norfolk, US	3
SZUlocation not on record	3
Winterthur, CH	3
Museo Achille Folettolocation not on record	3
Sevilla, ES	2
Johnson City, US	2
Taipei, TW	2
BGBMlocation not on record	2
Provo, US	2
Alicante, ES	2
Research Collection of B. A. Bennettlocation not on record	2
Musée des Confluenceslocation not on record	2
ASUlocation not on record	2
Podgorica, ME	2
Tromso University Museumlocation not on record	2
Canberra, AU	2
Tuscaloosa, US	2
SGAV-and-NHMDlocation not on record	2
Salvador, BR	2
Xiamen, CN	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
Philadelphia, US	2
Gifu prefectural Museumlocation not on record	2
Universidad de La Salle (La Salle)location not on record	2
Oulu, FI	2
Portland, US	2
Missoula, US	2
Moscow, US	2
Miami, US	2
Sendai, JP	2
Córdoba, AR	2
Columbia, US	2
Museo Entomologico de Leonlocation not on record	2
Minia, EG	2
OLAlocation not on record	2
H-Dunkellocation not on record	1
Seropédica, BR	1
Firenze, IT	1
Kew, GB	1
John May Museum of Natural Historylocation not on record	1
Saint Louis, US	1
Brock University (BU)location not on record	1
Whitewater, US	1
Tomioka, JP	1
Chapel Hill, US	1
Claremont, US	1
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	1
Ann Arbor, US	1
Knoxville, US	1
Badajoz, ES	1
H-Schuhwlocation not on record	1
Tsukuba, JP	1
Long Beach, US	1
UoB-IBlocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1
Arcata, US	1
Jackson, US	1
Uniwersytet w Białymstokulocation not on record	1
*unvoucheredlocation not on record	1
Trois-Rivières, CA	1
Phoenix, US	1
Mexico City, MX	1
University of North Carolina at Pembrokelocation not on record	1
Naturkundliche Sammlung Urilocation not on record	1
Museu Paraense Emílio Goeldilocation not on record	1
Iwate Prefectural Museumlocation not on record	1
HUN003location not on record	1
Taipei, TW	1
Due West, US	1
H-AkrKGlocation not on record	1
Otaru, JP	1
West Virginia Wesleyan Collegelocation not on record	1
Guangzhou, CN	1
Namur, BE	1
Odawara, JP	1
McGill University, Herbariumlocation not on record	1
Santa Barbara, US	1
Bend, US	1
Cheney, US	1
Edinburgh, GB	1
UFRRJlocation not on record	1
University of Alberta Museumslocation not on record	1
Jurica-Suchy Nature Museumlocation not on record	1
Bruce Peninsula National Parklocation not on record	1
Musee National d'histoire Naturelle Luxembourglocation not on record	1
University of Genevalocation not on record	1
Anchorage, US	1
Muséum Henri Lecoqlocation not on record	1
University of Wisconsinlocation not on record	1
Valdosta State Universitylocation not on record	1
Gijón, ES	1
Fulda, DE	1
Denver, US	1

245 institutions · 25 113 of 26 566 vouchered records shown · 972 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA36 detections

Where the DNA of Galium mollugo was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map8 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 11.5–19.9

Seasonal swing summer↔winter16.7 °C

Max temp (day)19.2 °C 13.6–25.9

Min temp (night)11.9 °C 7.90–15.5

Precipitation79.5 mm/mo 56.5–116

Air humidity60.7 % 55.1–63.9

Moisture balance-34.5 mm/mo -115–64.0

Vapour deficit749 Pa 504–1,082

Wind speed3.30 m/s 2.60–5.10

Cloud cover41.2 % 36.1–61.8

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources16 archives

Size & morphology20

Life cycle & reproduction14

Diet & foraging2

Habitat & environment14

Physiology & chemistry10

Other traits2

Compound class profile5 classes

Documented compounds123 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

At a glance

When this lineage existed

How it livedPBDB

Record type368 591 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions129 of 245 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type368 591 records