Galium labradoricum

(Wiegand) Wiegand · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Galium

At a glance

Occurrence records1 114

Data sources13

Biological traits14

DNA specimens7

eDNA detections4

Sources13 archives

Databases and archives Galium labradoricum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 114 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF1 114 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 24

01Narrative

Galium labradoricum (Labrador bedstraw or northern bog bedstraw) is a plant species in the family Rubiaceae. It is widespread across Canada, found in all provinces and territories except Yukon. It also occurs in St. Pierre & Miquelon and in the northern United States, primarily in New England and the Great Lakes region, from Maine to the Dakotas. It is endangered in Connecticut.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height0.3 m

Seed mass1 mg

Seed mass max1 mg

Seed mass min1 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galium labradoricum has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes5

GenBank sequences5

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG219622.1 ↗465 bpCanada · 2010

ACGT

TGCAGAATCACGTGAATCATCGAGTTTTTGAATGCAAGTTGCGCCCGAGGCCACTCGGCCGAGAGCACGTCTCCCTGGGCATCACGCATC …

Galium labradoricum voucher CCDB-18336-E11 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Galium labradoricum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 244×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.

CCDB · book-ipcn75-78 — Puff 1977

TreeOfSex · plant — Goldblatt1979 ↗

n 121×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Puff 1977

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 114 records

Wild obs. + sensor257

Museum / vouchered853

Cultivated / captive4

Origin

Native4

Range

Area of Occupancy AOO3 248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 76≤1 km 12≤10 km 3>10 km 25

116 georeferenced · 141 without coordinates

Open the mapobservation + sensor257

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 55≤1 km 146≤10 km 132>10 km 28

361 georeferenced · 492 without coordinates

Open the institutions mapphysical evidence853

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions35 of 53 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	135
Université Lavallocation not on record	95
Madison, US	94
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	86
Toronto, CA	86
Québec, CA	62
Ann Arbor, US	34
Montréal, CA	29
Saint John, CA	22
Green Bay, US	21
University of Alberta Museumslocation not on record	20
Bloomington, US	19
Burlington, US	14
Vancouver, CA	12
WINlocation not on record	12
Acadia Universitylocation not on record	11
Chongqing Museumlocation not on record	9
Mount Pleasant, US	6
New Haven, US	6
Victoria, CA	5
Bronx, US	4
University of New Hampshirelocation not on record	4
Chicago, US	4
Whitehorse, CA	3
Paris, FR	3
Royal Botanical Gardenslocation not on record	3
Bangkok, TH	3
Dekalb, US	3
Memorial University of Newfoundlandlocation not on record	2
Oskarshamn, SE	2
Wuzhou, CN	2
Wuhan, CN	2
University of Stellenboschlocation not on record	2
Science Museum of Minnesotalocation not on record	2
Philadelphia, US	2
Montréal, CA	2
Uppsala, SE	2
B.A. Bennett Herbariumlocation not on record	1
Research Collection of B. A. Bennettlocation not on record	1
Chicago, US	1
McWane Science Centerlocation not on record	1
Moscow, US	1
Ypsilanti, US	1
Lincoln, US	1
DULlocation not on record	1
Columbia, US	1
Chicago, US	1
University of Lethbridgelocation not on record	1
Whitewater, US	1
Canadian Museum of Naturelocation not on record	1
Fargo, US	1
Yukon Universitylocation not on record	1
New Brunswick, US	1

53 institutions · 839 of 853 vouchered records shown · 14 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Galium labradoricum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Larch Moss Fen

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 13.4–14.4

Seasonal swing summer↔winter39.7 °C

Max temp (day)19.2 °C 17.6–20.2

Min temp (night)9.40 °C 8.80–11.1

Precipitation84.2 mm/mo 80.8–106

Air humidity60.7 % 60.0–63.3

Moisture balance-7.40 mm/mo

Vapour deficit613 Pa 587–657

Wind speed3.60 m/s

Cloud cover42.0 % 41.8–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Galium labradoricum

At a glance

Sources13 archives

Size & morphology4

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 114 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions35 of 53 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 114 records