Galium humifusum

M.Bieb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Galium

At a glance

Occurrence records3 240

Data sources9

Biological traits23

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Galium humifusum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 240 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Chemical compositionLOTUS8 compounds

Occurrence & distributionGBIF3 240 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaTgenome

01Narrative

Подмаренник распростёртый, или Ясменник распростёртый — многолетнее травянистое растение, вид рода Подмаренник (Galium) семейства Мареновые (Rubiaceae). Впервые описан ботаником Фёдором Кондратьевичем Биберштейном.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max1 m

Plant height min0.1 m

Seed mass0.461 mg

Seed mass max0.46 mg

Seed mass min0.46 mg

Life cycle & reproduction6

Flowering endAug

Flowering startJun

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 600 m

Elevation min300 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTdesert, mountains, steppe

Woodinessnon-woody

Physiology & chemistry1

Leaf dry-matter content (LDMC)487 mg/g

Other traits1

Shoot orientationprostrate

03Chemical composition8 compounds

Compounds documented for Galium humifusum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Iridoids monoterpenoids8

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
Asperuloside	present	LOTUS
Asperulosidic Acid	present	LOTUS
Daphylloside	present	LOTUS
Deacetylasperuloside	present	LOTUS
Desacetylasperulosidic acid	present	LOTUS
Geniposidic Acid	present	LOTUS
Monotropein	present	LOTUS
Scandoside	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galium humifusum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ396162.1 ↗310 bpKazakhstan

ACGT

GATTCCGCGGCGGCGGAGGGCCGGCGTCTGAAAACGTAACCAATACGACTGTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAAC …

Galium humifusum voucher MG24 HER0082 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS3

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Galium humifusum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidypolyploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 240 records

Wild obs. + sensor2 317

Museum / vouchered871

Other52

Origin

Introduced6

Range

Area of Occupancy AOO7 996 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 1 248≤1 km 305≤10 km 69>10 km 48

1 670 georeferenced · 647 without coordinates

Open the mapobservation + sensor2 317

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 202≤1 km 91≤10 km 113>10 km 19

425 georeferenced · 446 without coordinates

Open the institutions mapphysical evidence871

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	297
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	38
UniKSlocation not on record	37
Wlocation not on record	37
Beijing, CN	32
Urumqi, CN	22
LDlocation not on record	20
Berlin, DE	17
Guangzhou, CN	11
BClocation not on record	6
Nanjing, CN	6
Pullman, US	6
Lanzhou, CN	5
Christchurch, NZ	3
WNNUlocation not on record	3
Bratislava, SK	3
Rishon Le Zion, IL	2
BRNUlocation not on record	2
WTUlocation not on record	2
GJOlocation not on record	2
GZUlocation not on record	2
Northridge, US	1
Wuzhou, CN	1
Xining, CN	1
PRClocation not on record	1

25 institutions · 557 of 871 vouchered records shown · 314 without an institution code

09Environmental DNA1 detections

Where the DNA of Galium humifusum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Galium humifusum

At a glance

Sources9 archives

Size & morphology5

Life cycle & reproduction6

Diet & foraging1

Habitat & environment9

Physiology & chemistry1

Other traits1

Compound class profile1 class

Documented compounds8 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 240 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type3 240 records