Galium capense

Thunb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Galium

At a glance

Occurrence records108

Data sources10

Biological traits15

DNA specimens2

eDNA detections1

Sources10 archives

Databases and archives Galium capense's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility108 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF108 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 22

01Narrative

Galium capense là một loài thực vật có hoa trong họ Thiến thảo. Loài này được Thunb. mô tả khoa học đầu tiên năm 1794.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max2 m

Plant height min0.15 m

Life cycle & reproduction3

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max3 100 m

Elevation min60 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galium capense has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR392091.1 ↗536 bp

ACGT

TCGAATCCTGCAAACGACCGCGAACACGTTAAACAAAAACCGCGGGGCGCCGGCCGGACCTAAGAAATCCGGCAGGCCCTCGCACCAAAC …

Galium capense voucher Muasya & Zhigila 8205 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Galium capense carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 224×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Puff, C. 1978. Chromosome numbers of some southern African Rubiaceae-Rubicae. Linzer Biol. Beitr. 9: 203–212.

CCDB · book-ipcn75-78 — Puff 1978

TreeOfSex · plant — Goldblatt1979 ↗

n 113×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · TreeOfSex · plant

CCDB · ipcn-api-dl — Puff, C. 1978. Chromosome numbers of some southern African Rubiaceae-Rubicae. Linzer Biol. Beitr. 9: 203–212.

CCDB · book-ipcn75-78 — Puff 1978

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type108 records

Wild obs. + sensor88

Museum / vouchered20

Range

Area of Occupancy AOO360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 58≤1 km 8≤10 km 3>10 km 1

70 georeferenced · 18 without coordinates

Open the mapobservation + sensor88

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 6

6 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	2
Stockholm, SE	1
South African National Biodiversity Institute, Compton Herbariumlocation not on record	1
CASlocation not on record	1
Bronx, US	1
Kew, GB	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

8 institutions · 9 of 20 vouchered records shown · 11 without an institution code

09Environmental DNA1 detections

Where the DNA of Galium capense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 20.1–20.1

Seasonal swing summer↔winter12.4 °C

Max temp (day)26.8 °C

Min temp (night)13.1 °C

Precipitation63.2 mm/mo

Air humidity50.0 %

Moisture balance-86.2 mm/mo

Vapour deficit1,175 Pa

Wind speed3.00 m/s

Cloud cover16.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)