Galium boreale
speciesAt a glance
Occurrence records166 972
Data sources13
Biological traits120
DNA specimens60
eDNA detections28
Sources13 archives
Databases and archives Galium boreale's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility166 972 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics60 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources120 traits
Occurrence & distributionGBIF166 972 records
Environmental DNA1 datasets · 8 countries28 detections
DNA & barcodingBOLD · NCBI60 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex1.3 Gbp
01Narrative
Le gaillet boréal est une plante herbacée vivace de la famille des Rubiacées, du genre Galium.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology10
Leaf mass2.4 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 49.01 mm² · GIFT: 49.0 mm²
Plant height0.614 m
⚠ sources differ — GIFT: 0.614 m · LEDA: 0.325 m · USDA: 0.914 m · TRY: 0.233 m
Plant height generative0.402 m
Plant height max0.9 m
Plant height min0.2 m
Seed length1.75 mm
Seed mass0.673 mg
⚠ sources differ — TRY: 0.673 mg · LEDA: 0.621 mg · GIFT: 0.654 mg
Seed mass max0.85 mg
Seed mass min0.5 mg
Life cycle & reproduction36
After harvest regrowth rateSlow
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessevergreen
Dispersal typeanimal
Flower colourwhite
Flower conspicuousYes
Flowering endAug
Flowering startJun
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial or subshrub
Life spanperennial
Lifespan categoryModerate
Lifespan years3 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number103
Seed spread rateModerate
Seedling vigorMedium
Self fertilizationpresent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment28
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max3 000 m
Elevation min2 200 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Growth formherb
Growth form USDASingle Crown
Habitat GIFTforest
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min6 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry26
Anaerobic toleranceNone
C:N ratioMedium
Caco3 toleranceHigh
Cold stratification requiredYes
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceLow
Frost free days min85 days
Leaf C:N ratio22.0 g/g
Leaf c435 mg/g
Leaf dry-matter content (LDMC)283 mg/g
⚠ sources differ — TRY: 283 mg/g · LEDA: 210 mg/g
Leaf n21.03 mg/g
Leaf p1.73 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max55 in
Precipitation min20 in
Salinity toleranceNone
Seed longevity index0
Shade toleranceMedium
Soil pH max7.2 pH
Soil pH min5 pH
Specific leaf area (SLA)25.44 mm²/mg
⚠ sources differ — TRY: 25.44 mm²/mg · LEDA: 19.54 mm²/mg · GIFT: 19.41 mm²/mg
Temperature min-33 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityContracting Only
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound725 760 per lb
ToxicityNone
Veneer productNo
Other traits5
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
05DNA & barcoding60 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galium boreale has left across the world's sequence archives.
At a glance
DNA specimens60
Marker genes10
GenBank sequences10
eDNA detections28
Countries9
The DNA barcodea real sequence read deposited for this species
GGGCCGGGGATCTGAAACGAAACCAATACAACTCTCGGAAAGGGATATCTAGGCTCTCGTATCAATGAAAAACGAAGAAAAATGCGATAT …
Galium boreale voucher ALT23-163 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL6★rbcLa★trnL-F★ITS2★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · TreeOfSex · NCBI
The complete instruction manual Galium boreale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 251 840 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Galium boreale1.25 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 44 n = 22
Ploidypolyploid inferred
Chromosome records22–662n range44median44mode44records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4424×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · iapt +11
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Letz R., Uhríková A. & Májovský J., 1999: Chromosome numbers of several interesting taxa of the flora of Slovakia. - Biologia (Bratislava) 54/1: 43-49.
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · brit-fl — Kliphuis, E. Proc. Kon. Ned. Akad. Wetensch. C. 76: 359-372 (1973)
CCDB · brit-fl — Rahn, K. Bot. Tidsskr. 56: 351-354 (1961)
CCDB · brit-fl — Dale, A. Watsonia 12: 334 (1979)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3778
CCDB · fl-europaea — Skalinska et al.,
CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Anchev, M. E. 1982a. Taxonomic study of Galium L. in Bulgaria. II. Karyological and pollen structural investigation. Fitologija 19: 43–68. (In Bulgarian).
CCDB · ipcn-api-dl — KLIPHUIS, E. 1986. Cytotaxonomic investigations on some species of the genus Galium (Rubiaceae) from the Balcans. Nordic J. Bot. 6: 15–20.
CCDB · ipcn-api-dl — Belaeva, V. A. & V. Siplivinsky. 1981. In Chromosome number reports LXXIII. Taxon 30: 857–860.
CCDB · ipcn-api-dl — Letz, R., A. Uhríková & J. Májovský. 1999. Chromosome numbers of several interesting taxa of the flora of Slovakia. Biologia (Bratislava) 54: 43–49.
CCDB · ipcn-api-dl — Nishikawa, T. 1985. Chromosome counts of flowering plants of Hokkaido (9). J. Hokkaido Univ. Educ., Sect. 2B 36: 25–40.
CCDB · book-ipcn75-78 — Belaeva & Siplivinsky 1975
CCDB · book-ipcn73-74 — SUROVA, T.D. 1973. Chromosome numbers of some species of genera Galium L. and Cruciata Mill. of the North-West European part of the u.s.s-.-R-.---- (in Russian) Bot. zurn. (Moscow & Leningrad) 58: 1819-1824.
CCDB · book-ipcn73-74 — ANCEV, M.E. 1974. In IOPB chromosome number reports XLIV. Taxon 23: 373-380.
CCDB · book-atlas-flowering-plants — LOve & L. 1954
CCDB · Cave1956 — Love & Love b
CCDB · Cave1962 — Kliphuis 1962b
TreeOfSex · plant — Goldblatt1979 ↗
2n 6618×CCDB · slov-fl · CCDB · fl-europaea · CCDB · poland +7
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · slov-fl — Murín A. & Záborský J., 1976: [Report], pp. 489. - In: Löve Á. (ed.), IOPB Chromosome number reports LIII, Taxon 25 /4.
CCDB · fl-europaea — Skalinska et al.,
CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1984. In R.E. Krogulevich & T.S. Rostovtseva, Khromosomnye Chisla Tsvetkovykh Rastenii i Sibiri Dal'nego Vostoka. Izdatel'stvo "Nauka", Sibirskoe Otdelenie, Novosibirsk. ý.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.
CCDB · ipcn-api-dl — Dale, A. 1979. Chromosome numbers of British Plants, 6. Watsonia 0.731944444.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · book-ipcn75-78 — Zhukova et al. 1977a
CCDB · book-ipcn75-78 — Uhrikova 1974a
CCDB · book-ipcn73-74 — ZHUKOVA, P.G., V.V. PETROVSKY, & T.N. PLIEVA. 1973. The chromosome numbers and taxonomy of some plant species from Siberia and Far East. (in Russian) Bot. zurn. (Moscow & Leningrad) 58: 1331-1342.
CCDB · book-ipcn73-74 — SUROVA, T.D. 1973. Chromosome numbers of some species of genera Galium L. and Cruciata Mill. of the North-West European part of the u.s.s-.-R-.---- (in Russian) Bot. zurn. (Moscow & Leningrad) 58: 1819-1824.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-atlas-flowering-plants
CCDB · Cave1959 — Skalinska et al. 1959
CCDB · Cave1963 — Sokolovskaya 1963
TreeOfSex · plant — Goldblatt1979 ↗
2n 222×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl
GoaT · Tree of Sex Database — ↗
CCDB · ipcn-api-dl — Murin, A., I. Haberova & C. Zamsran. 1980. Karyological studies of some species of the Mongolian flora. Folia Geobot. Phytotax. 15: 395–405.
2n 552×CCDB · fl-europaea · CCDB · poland
CCDB · fl-europaea — Skalinska et al.,
CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.
n 332×CCDB · book-ipcn66 · CCDB · Cave1962
CCDB · book-ipcn66 — Taylor & Brockman 1966
CCDB · Cave1962 — Lewis 1962d
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness97.8% BUSCO
08Occurrence & distribution
Record type166 972 records
Wild obs. + sensor151 414
Museum / vouchered14 870
Cultivated / captive12
Fossil1
Other675
Origin
Native4 384
Introduced2
Range
Area of Occupancy AOO265 500 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy69% within 1 km
≤100 m 60 876≤1 km 26 626≤10 km 37 934>10 km 2 014
127 450 georeferenced · 23 964 without coordinates
Open the mapobservation + sensor151 414
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy41% within 1 km
≤100 m 873≤1 km 3 079≤10 km 5 016>10 km 678
9 646 georeferenced · 5 224 without coordinates
Open the institutions mapphysical evidence14 870
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 11
12 georeferenced
Open the mapnot free-living12
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions175 of 328 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 2 675 |
| Moscow State Universitylocation not on record | 985 |
| BFLlocation not on record | 521 |
| Olocation not on record | 477 |
| LDlocation not on record | 445 |
| St. Paul, US | 404 |
| Madison, US | 342 |
| Uppsala, SE | 249 |
| Provincia di Livornolocation not on record | 218 |
| Oulu, FI | 216 |
| Trondheim, NO | 194 |
| Beijing, CN | 188 |
| Bronx, US | 187 |
| WTUlocation not on record | 186 |
| Oskarshamn, SE | 178 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 164 |
| Turku, FI | 150 |
| SLU Artdatabankenlocation not on record | 150 |
| Pullman, US | 139 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 133 |
| Chongqing Museumlocation not on record | 131 |
| Missoula, US | 126 |
| Bergen, NO | 121 |
| Albuquerque, US | 119 |
| Salzburg, AT | 117 |
| Wuzhou, CN | 115 |
| TROMlocation not on record | 113 |
| Garðabær, IS | 110 |
| Moscow, US | 109 |
| Adam Mickiewicz University in Poznańlocation not on record | 109 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 109 |
| Philadelphia, US | 104 |
| Denver, US | 104 |
| Tartu, EE | 95 |
| Corvallis, US | 93 |
| Jyväskylä, FI | 88 |
| Bern, CH | 84 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 81 |
| University of Alberta Museumslocation not on record | 81 |
| Bozeman, US | 78 |
| Ann Arbor, US | 78 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 77 |
| Tallinn, EE | 77 |
| Philadelphia, US | 77 |
| Toronto, CA | 73 |
| GJOlocation not on record | 73 |
| Kuopio, FI | 71 |
| Vancouver, CA | 64 |
| Chadron, US | 62 |
| KMNlocation not on record | 60 |
| Spearfish, US | 59 |
| Bloomington, US | 57 |
| Victoria, CA | 56 |
| University of Lethbridgelocation not on record | 55 |
| Uniwersytet Warszawskilocation not on record | 52 |
| DOI/NPS, Greenbelt Parklocation not on record | 50 |
| WINlocation not on record | 48 |
| Green Bay, US | 43 |
| Pocatello, US | 39 |
| Xining, CN | 37 |
| New Haven, US | 36 |
| Boise, US | 33 |
| Yangling, CN | 32 |
| Mlocation not on record | 32 |
| BRNUlocation not on record | 31 |
| LfUlocation not on record | 31 |
| Anchorage, US | 31 |
| University of Stellenboschlocation not on record | 29 |
| MeiseBGlocation not on record | 29 |
| Flagstaff, US | 29 |
| 26 | |
| GMBAlocation not on record | 25 |
| Riverside, US | 24 |
| Görlitz, DE | 24 |
| Logan, US | 24 |
| Berlin, DE | 23 |
| Porvoo, FI | 23 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 22 |
| Durango, US | 22 |
| IWEP FEB RASlocation not on record | 22 |
| Provo, US | 22 |
| Frankfurt am Main | 21 |
| TUR-Alocation not on record | 21 |
| Québec, CA | 21 |
| University of New Hampshirelocation not on record | 20 |
| Helsinki, FI | 19 |
| DBF-NHMDlocation not on record | 19 |
| WNNUlocation not on record | 18 |
| Emporia, US | 18 |
| Yukon Universitylocation not on record | 17 |
| OLAlocation not on record | 17 |
| Stockholm, SE | 16 |
| Grand Junction, US | 16 |
| ASUlocation not on record | 16 |
| Cheney, US | 15 |
| Urumqi, CN | 14 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 14 |
| Saint John, CA | 14 |
| Wuhan, CN | 13 |
| Allentown, US | 13 |
| Saint Louis, US | 13 |
| Wlocation not on record | 13 |
| CJBGlocation not on record | 13 |
| Dekalb, US | 13 |
| Whitewater, US | 13 |
| USFS/BHSClocation not on record | 13 |
| EL PASO, US | 12 |
| Urumqi, CN | 12 |
| Kyoto Universitylocation not on record | 12 |
| Tempe, US | 11 |
| Paris, FR | 11 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 11 |
| València, ES | 11 |
| Zhengzhou, CN | 11 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 11 |
| Montréal, CA | 10 |
| NSMKlocation not on record | 10 |
| Claremont, US | 10 |
| Kandalaksha State Nature Reservelocation not on record | 10 |
| Université Lavallocation not on record | 10 |
| Waverly, US | 10 |
| Shanxi Institute of Biologylocation not on record | 10 |
| Frauenfeld, CH | 9 |
| Dresden, DE | 9 |
| Burlington, US | 9 |
| SWlocation not on record | 9 |
| Vitoria, ES | 9 |
| MAlocation not on record | 9 |
| GZUlocation not on record | 9 |
| PRClocation not on record | 9 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 9 |
| Acadia Universitylocation not on record | 9 |
| Servico de Microbiologia e Imunologialocation not on record | 9 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 9 |
| Institute of the biological problems of the North FEB RASlocation not on record | 9 |
| SZUlocation not on record | 9 |
| Entomological Society of Latvialocation not on record | 9 |
| ENTClocation not on record | 8 |
| Bourges, FR | 8 |
| Caldwell, US | 8 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 8 |
| Davenport, US | 8 |
| Rovaniemi, FI | 8 |
| Rocky Mountain Biological Laboratorylocation not on record | 8 |
| Fargo, US | 8 |
| NMBU:MINAlocation not on record | 8 |
| Inner Mongolia Universitylocation not on record | 7 |
| AUAlocation not on record | 7 |
| BIO-UNIPIlocation not on record | 7 |
| Jiangxi College of Educationlocation not on record | 7 |
| Pittsburg, US | 7 |
| Salamanca, ES | 7 |
| Lincoln, US | 7 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 7 |
| Barcelona, ES | 7 |
| US | 7 |
| Chengdu, CN | 7 |
| Porrentruy, CH | 7 |
| Mount Pleasant, US | 7 |
| South Kensington, GB | 7 |
| Christchurch, NZ | 7 |
| San Diego, US | 7 |
| Sion, CH | 7 |
| Tacoma, US | 7 |
| Tianjin Natural History Museumlocation not on record | 6 |
| Chengdu, CN | 6 |
| QAUlocation not on record | 6 |
| Orem, US | 6 |
| Uniwersytet Opolskilocation not on record | 6 |
| Nanjing, CN | 6 |
| Millersville, US | 6 |
| Northridge, US | 6 |
| IDElocation not on record | 6 |
| Xian, CN | 6 |
| Philadelphia, US | 6 |
| Fulda, DE | 6 |
| Kunming, CN | 6 |
| KR | 6 |
| PrivatHerblocation not on record | 6 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 6 |
| Lanzhou, CN | 5 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 5 |
| Portland, US | 5 |
| Universität Göttingenlocation not on record | 5 |
| Pamplona, ES | 5 |
| Chengdu, CN | 5 |
| Forssa, FI | 5 |
| Tsukuba, JP | 5 |
| BAYLUlocation not on record | 5 |
| Phoenix, US | 4 |
| Guangzhou, CN | 4 |
| McWane Science Centerlocation not on record | 4 |
| Bangkok, TH | 4 |
| Angwin, US | 4 |
| LPMMBHlocation not on record | 4 |
| Weber State Universitylocation not on record | 4 |
| Chicago, US | 4 |
| Samara National Research Universitylocation not on record | 4 |
| BSBIlocation not on record | 4 |
| Tromso University Museumlocation not on record | 4 |
| San Luis Obispo, US | 4 |
| Ashland, US | 4 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| CASlocation not on record | 3 |
| Tula State Universitylocation not on record | 3 |
| Nanjing, CN | 3 |
| Royal Botanical Gardenslocation not on record | 3 |
| Guilin, CN | 3 |
| Karlsruhe, DE | 3 |
| Wellington, NZ | 3 |
| Shanxi Universitylocation not on record | 3 |
| Taipei, TW | 3 |
| Bend, US | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 3 |
| Dhaka, BD | 3 |
| Columbia, US | 3 |
| Göteborg, SE | 3 |
| National Museum Waleslocation not on record | 3 |
| Zürich, CH | 3 |
| Brookings, US | 3 |
| Knoxville, US | 3 |
| Durham, US | 3 |
| Xiamen, CN | 2 |
| Riyadh Municipalitylocation not on record | 2 |
| Whitehorse, CA | 2 |
| Komarov Botanical Institutelocation not on record | 2 |
| Northeastern Forestry Universitylocation not on record | 2 |
| GB | 2 |
| Museum of the Rockieslocation not on record | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Madrid, ES | 2 |
| Davis, US | 2 |
| STNFlocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| FLADlocation not on record | 2 |
| Norfolk, US | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| Taipei, TW | 2 |
| Ypsilanti, US | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| DULlocation not on record | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Arcata, US | 2 |
| H-AkrKGlocation not on record | 2 |
| Minot State Universitylocation not on record | 2 |
| San Angelo, US | 2 |
| Yellowstone National Park Herbariumlocation not on record | 2 |
| University of South Dakotalocation not on record | 2 |
| Williamsburg, US | 2 |
| Chapel Hill, US | 2 |
| San Jose, US | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Chicago, US | 2 |
| Granada, ES | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Yunnan Universitylocation not on record | 2 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 2 |
| H-Schuhwlocation not on record | 2 |
| Guiyang, CN | 2 |
| Awka, NG | 2 |
| New Mexico Museum of Natural History and Sciencelocation not on record | 1 |
| Little Rock, US | 1 |
| Xinxiang, CN | 1 |
| Madrid, ES | 1 |
| Tilburg, NL | 1 |
| Jaén, ES | 1 |
| Santa Barbara, US | 1 |
| GINRlocation not on record | 1 |
| Kew, GB | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| College Park, US | 1 |
| Umeå Universitylocation not on record | 1 |
| University of Birminghamlocation not on record | 1 |
| Dover, US | 1 |
| Museo Achille Folettolocation not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Podgorica, ME | 1 |
| Decorah, US | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Walla Walla, US | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| Montréal, CA | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Centre for Biodiversity Genomicslocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Miami, US | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Korea National Arboretumlocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Staten Island, US | 1 |
| Elikins, US | 1 |
| Memorial University of Newfoundlandlocation not on record | 1 |
| Henderson, US | 1 |
| University of Hulllocation not on record | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| Turlock, US | 1 |
| Research Collection of Jonathan Farrlocation not on record | 1 |
| Austin, US | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| nbflocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Winterthur, CH | 1 |
| Taiyuan Normal Universitylocation not on record | 1 |
| Guangzhou, CN | 1 |
| Seoul, KR | 1 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| Royal Alberta Museumlocation not on record | 1 |
| Mississippi State, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| FLASlocation not on record | 1 |
| BClocation not on record | 1 |
| No collectionlocation not on record | 1 |
| Cslocation not on record | 1 |
| NMWlocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Chicago, US | 1 |
| Shenyang Agricultural Universitylocation not on record | 1 |
| Long Beach, US | 1 |
| Badajoz, ES | 1 |
328 institutions · 13 373 of 14 870 vouchered records shown · 1 395 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA28 detections
Where the DNA of Galium boreale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found28
Studies independent surveys1
Countries8
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 28 detections have coordinates
Open the map8 countries0
Trinity College Botanical Gardens, Growing i…Aspen grove with camas spp., conifer spp., r…Phleum, POAPRA, old hayfieldFlat meadow
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.1 °C 6.10–19.8
Seasonal swing summer↔winter24.9 °C
Max temp (day)18.4 °C 8.60–25.0
Min temp (night)9.80 °C 3.50–15.1
Precipitation76.0 mm/mo 54.1–118
Air humidity59.3 % 50.2–65.3
Moisture balance-31.2 mm/mo -95.8–48.5
Vapour deficit658 Pa 324–993
Wind speed3.50 m/s 2.40–5.50
Cloud cover43.2 % 28.6–63.6
CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.