Galium aparine
speciesAt a glance
Occurrence records1 011 852
Data sources17
Biological traits145
DNA specimens82
eDNA detections183
Sources17 archives
Databases and archives Galium aparine's data was compiled from.
WikipediaWikimedia Foundation12 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility1 011 852 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI183 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics82 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources145 traits
Chemical compositionLOTUS · NPASS44 compounds
Occurrence & distributionGBIF1 011 852 records
Environmental DNA6 datasets · 17 countries183 detections
DNA & barcodingBOLD · NCBI82 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex1.1 Gbp
01Narrative
Galium aparine, with common names including cleavers, clivers, catchweed and sticky willy among others, is an annual, herbaceous plant of the family Rubiaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology22
Fruit length4 mm
⚠ sources differ — AusTraits: 4 mm · GIFT: 3 mm
Leaf length40 mm
Leaf length max70 mm
Leaf length min10 mm
Leaf mass5.43 mg
Leaf size655 mm²
⚠ sources differ — TRY: 655 mm² · LEDA: 178 mm² · GIFT: 161 mm²
Leaf width5 mm
Leaf width max9 mm
Leaf width min2 mm
Plant height0.559 m
⚠ sources differ — GIFT: 0.559 m · AusTraits: 0.7 m · LEDA: 0.675 m · USDA: 0.274 m · TRY: 0.544 m
Plant height generative0.225 m
Plant height max2 m
Plant height min0.05 m
Seed length2.67 mm
⚠ sources differ — TRY: 2.67 mm · GIFT: 2.3 mm
Seed length max2.3 mm
Seed length min2.3 mm
Seed mass8.14 mg
⚠ sources differ — TRY: 8.14 mg · AusTraits: 8.9 mg · LEDA: 9.54 mg · GIFT: 6.41 mg
Seed mass max22.7 mg
Seed mass min4.07 mg
Seed volume9.5 mm³
Seed volume max12 mm³
Seed volume min7 mm³
Life cycle & reproduction39
Bloom periodMid Spring
Coppice potentialNo
Deciduousnessdeciduous
Dispersal typeanimal
Flower colourwhite
⚠ sources differ — GIFT: white · USDA: Green
Flower conspicuousNo
Flower width max3 mm
Flower width min1.5 mm
Flowering endAug
Flowering startJun
Flowering timennnnnnnnyynn
Fruit seed period beginSpring
Fruit seed period endSpring
Growth rate USDARapid
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formLiana
⚠ sources differ — LEDA: Liana · GIFT: therophyte
Reproduction asexualabsent
Reproductive maturity1 years
Resprout abilityNo
Resprouting capacityfire_killed
Seed number350
Seed spread rateModerate
Seedling vigorMedium
Self fertilizationpresent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment33
Active growth periodSpring
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max4 300 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Fruit fleshinessdry
Fruit typemericarp
Growth formherb
Growth form USDASingle Crown
Habitat GIFTÁrea Antrópica
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf formoblong
Leaf retentionNo
Leaf shapeoblanceolate
Low growing grassNo
Mycorrhiza typeAMNM
Root depth min4 in
Shape and orientationDecumbent
Small grainNo
Woodinessnon-woody
Physiology & chemistry28
Anaerobic toleranceLow
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceNone
Fertility requirementHigh
Fire resistantNo
Fire toleranceNone
Frost free days min60 days
Leaf C:N ratio16.89 g/g
Leaf c409 mg/g
Leaf dry-matter content (LDMC)182 mg/g
⚠ sources differ — TRY: 182 mg/g · LEDA: 135 mg/g
Leaf n29.44 mg/g
Leaf p4.3 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max55 in
Precipitation min14 in
Salinity toleranceNone
Seed longevity index0
Shade toleranceLow
Soil pH max7.2 pH
Soil pH min5.4 pH
Specific leaf area (SLA)42.84 mm²/mg
⚠ sources differ — TRY: 42.84 mm²/mg · LEDA: 34.15 mm²/mg · GIFT: 34.68 mm²/mg
Temperature min52 °F
Wood density125 mg/cm³
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound500 000 per lb
ToxicityNone
Veneer productNo
Other traits8
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
Leaf arrangementwhorled
Seeds per fruit101-1000
Shoot orientationerect
03Chemical composition44 compounds
Compounds documented for Galium aparine across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Anthraquinones and anthrones12
Quinoline alkaloids6
Acridone alkaloids4
Iridoids monoterpenoids4
Acridone alkaloids $ Quinoline alkaloids2
Documented compounds44 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Secoisolariciresinol | present | NPASS | |
| (+/-)-2-Hydroxypiperitone | present | NPASS | |
| (4R)-1-hydroxy-2,4-dimethoxy-10-methyl-4-(3-methylbut-2-enyl)acridine-3,9-dione | present | NPASS | |
| (4S)-4-[(2E)-3,7-dimethylocta-2,6-dienyl]-1-hydroxy-2,4-dimethoxy-10-methylacridine-3,9-dione | present | NPASS | |
| (5-(hexopyranosyloxy)-1-oxo-2a,4a,5,7b-tetrahydro-1H-2,6-dioxacyclopenta(cd)inden-4-yl)methyl acetate | present | LOTUS | |
| 1,2-Dihydroxy-6-methylanthracene-9,10-dione | present | LOTUS | |
| 1,3-Dihydroxy-2-(methoxymethoxy)anthracene-9,10-dione | present | LOTUS | |
| 1,5,7-Trihydroxy-6-methoxy-2-methylanthraquinone | present | LOTUS | |
| 1,7-Dihydroxy-6,8-dimethoxy-2-methylanthraquinone | present | LOTUS | |
| 1-Hydroxy-2-methylanthraquinone | present | LOTUS |
05DNA & barcoding82 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galium aparine has left across the world's sequence archives.
At a glance
DNA specimens82
Marker genes9
GenBank sequences10
eDNA detections183
Countries17
The DNA barcodea real sequence read deposited for this species
GTGAATCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCACTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCTCGTCACCGCC …
Galium aparine voucher PLT.0141 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL4★rbcLa★ITS3★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · TreeOfSex · NCBI
The complete instruction manual Galium aparine carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 056 240 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Galium aparine1.06 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 66 n = 33
Ploidypolyploid inferred
Chromosome records42–862n range64median66mode81records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 6635×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ita-fl · CCDB · slov-fl +9
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ita-fl — KLIPHUIS E. - 1962. Cytotaxonomical studies on the genus Galium. A preliminary report.. Proc. Kon. Ned. Akad. Wetensch. (Amsterdam), ser. C , 65: 279-285.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Váchová M. & Feráková V., 1978: [Report], pp. 382-383. - In: Löve Á. (ed.), IOPB Chromosome number reports LXI, Taxon 27 /4.
CCDB · brit-fl — Wentworth, J.E., Bailey, J.P., Gornall, R.J. Watsonia 18: 415-418 (1991)
CCDB · brit-fl — McAllister, H. (1992)
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3790
CCDB · fl-europaea — Ancev, 1974
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Wentworth, J. E., J. P. Bailey & R. J. Gornall. 1991. Contributions to a cytological catalogue of the British and Irish flora, 1. Watsonia 18: 415–417.
CCDB · ipcn-api-dl — Donneaux, A. 1981. Contribution a l'etude cytotaxonomique du genre Galium L. s.l. (Rubiaceae) en Belgique et dans les regions voisines. Lejeunia 103: 1–74.
CCDB · book-ipcn75-78 — Loon & Jong 1978
CCDB · book-ipcn75-78 — Vachova & Ferakova 1978
CCDB · book-ipcn75-78 — Moore 197 5
CCDB · book-ipcn73-74 — ANCEV, M.E. 1974. In IOPB chromosome number reports XLIV. Taxon 23: 373-380.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.
CCDB · book-ipcn73-74 — STRID, A. 1971. Chromosome numbers in some Albanian angiosperms. Bot. Notiser 124: 490-496.
CCDB · book-indian_vol1 — Murin & Vachoa (Fedorov) ; Podlech, D. & Dieterle, A. 1969 ; Majovsky, J. eta!. 1970a ; Strid, A. 1971 ; Ancev, M.E. 1974a ; Moore, R.J. l975a ; Vachova, M. & Ferakova, v. 1978 ; Van Loon, J. Chr. & de Jong, H. 1978 ; Brand, C.V.D. et al. 1979
CCDB · CromoCat 2015 — Ancev, M. E. (1974a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIV]. Taxon 23(2/3): 374-375.
CCDB · CromoCat 2015 — Ancev, M. E. (1978b). Taxonomicno proucvane na rod Galium L.v. Bulgarija V. Evoljucija na cvetnite rastenija i florogenez 1: 107-147.
CCDB · CromoCat 2015 — Den Brand, C., van, van Meel, F. C. M. & Wieffering, J. H. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIV]. Taxon 28(4): 395-397.
CCDB · CromoCat 2015 — Donneaux, A. (1981). Contribution à l'étude cytotaxonomique du genre Galium L. s. l. (Rubiaceae) en Belgique et dans les régions voisines Lejeunia 103: 1-75.
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1963). Chromosome numbers of flowering plants in the Netherlands. Acta Bot. Neerl. 12(2): 195-230.
CCDB · CromoCat 2015 — Kliphuis, E. (1962). Chromosome numbers of some annual Trifolium species, occurring in the Netherlands. Acta Bot. Neerl. 11: 90-92.
CCDB · CromoCat 2015 — Kliphuis, E. (1980). Cytotaxonomic studies on Galium aparine L. Proceedings C 83(1): 53-64.
CCDB · CromoCat 2015 — Loon van, J. C. & de Jong, H. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIX]. Taxon 27(1): 56-61.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1974b). Cytotaxonomy of Spanish plants. IV.-Dicotyledons: Caesalpinaceae-Asteraceae. Lagascalia 4(2): 153-211.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXV]. Taxon 31(2): 344-360.
CCDB · CromoCat 2015 — Moore, R. J. (1975a). The Galium aparine complex in Canada. Canad. J. Bot. 53: 877-893.
CCDB · CromoCat 2015 — Podlech, D. & A. Dieterle. (1969). Chromosomenstudien an afghanischen Pflanzen. Candollea 24(2): 185-243.
CCDB · CromoCat 2015 — Uhríková, A. & A. Murín. (1970). Reports (In Májovsky, J. & al. (ed.), Index of chromosome numbers of slovakian flora. Part 2). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 18: 45-60.
CCDB · CromoCat 2015 — Váchová, M. & V. Feráková. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXI]. Taxon 27(4): 382-383.
CCDB · CromoCat 2015 — Wentworth, J. E., J. P. Bailey & R. J. Gornall. (1991). Contributions to a cytological catalogue of the British and Irish flora, 1. Watsonia 18: 415-417.
2n 6426×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-indian_vol1 +2
CCDB · iber-fl — Notas cariolgicas em Rubiaceae portuguesas. Queirs, M.Bol. Soc. Brot. ser. 259: 233-243(1987).
CCDB · ipcn-api-dl — Queirós, M. 1987. Notas cariológicas em Rubiaceae Portuguesas. Bol. Soc. Brot., sér. 2 59: 233–243.
CCDB · ipcn-api-dl — Queirós, M. 1986. Notas cariológicas em Rubiaceae Portuguesas. Bol. Soc. Brot., sér. 2 59: 233–243.
CCDB · ipcn-api-dl — Anchev, M. E. 1982a. Taxonomic study of Galium L. in Bulgaria. II. Karyological and pollen structural investigation. Fitologija 19: 43–68. (In Bulgarian).
CCDB · ipcn-api-dl — KLIPHUIS, E. 1986. Cytotaxonomic investigations on some species of the genus Galium (Rubiaceae) from the Balcans. Nordic J. Bot. 6: 15–20.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Van Den Brand, C., F. C. M. V. Meel & J. H. Wieffering. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 395–397.
CCDB · ipcn-api-dl — KLIPHUIS, E. 1980. Cytotaxonomic studies on Galium aparine L. Proc. Kon. Ned. Akad. Wetensch., C 83: 53–64.
CCDB · book-indian_vol1 — Bocher, T.W. et al. 1955a
CCDB · CromoCat 2015 — Queirós, M. (1987). Notas cariológicas em Rubiaceae portuguesas. Bol. Soc. Brot. 59: 233-243.
CCDB · CromoCat 2015 — Ancev, M. E. (1978b). Taxonomicno proucvane na rod Galium L.v. Bulgarija V. Evoljucija na cvetnite rastenija i florogenez 1: 107-147.
CCDB · CromoCat 2015 — Ancev, M. E. (1982c). Taxonomic study of genus Galium L. in Bulgaria. II. Karyological and pollen structural investigation. Bulg. Acad. Sci., Phytology 19: 43-68.
CCDB · CromoCat 2015 — Bocher, W., Larsen, K. & Rahn, K. (1955). Experimental and cytological studies on plant species III. Plantago coronopus and allied species. Hereditas 41: 423-453.
CCDB · CromoCat 2015 — Den Brand, C., van, van Meel, F. C. M. & Wieffering, J. H. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIV]. Taxon 28(4): 395-397.
CCDB · CromoCat 2015 — Dobeš, C., Hahn, B. & Morawetz, W. (1997). Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5-43.
CCDB · CromoCat 2015 — Donneaux, A. (1981). Contribution à l'étude cytotaxonomique du genre Galium L. s. l. (Rubiaceae) en Belgique et dans les régions voisines Lejeunia 103: 1-75.
CCDB · CromoCat 2015 — Fagerlind, F. (1934). Beiträge zur Kenntnis der Zytologie der rubiaceen. Hereditas 19: 223-232.
CCDB · CromoCat 2015 — Fagerlind, F. (1937). Embryologische, zytologische und bestäubungs experimentelle Studien in der Familie Rubiaceae nebst Bemerkungen über einige Polyploiditätsprobleme. Acta Horti Berg. 11: 195-470.
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1963). Chromosome numbers of flowering plants in the Netherlands. Acta Bot. Neerl. 12(2): 195-230.
CCDB · CromoCat 2015 — Kliphuis, E. (1980). Cytotaxonomic studies on Galium aparine L. Proceedings C 83(1): 53-64.
CCDB · CromoCat 2015 — Kliphuis, E. (1986). Cytotaxonomic investigations on some species of the genus Galium (Rubiaceae) from the Balkans. Nord. J. Bot. 6: 15-20.
CCDB · CromoCat 2015 — Lövkvist, B. & Hultgård, U.-M. (1999). Chromosome numbers in south Swedish vascular plants Opera botanica 137: 1-42
CCDB · CromoCat 2015 — Queirós, M. (1986). Notas cariológicas em Rubiaceae Portuguesas. Bol. Soc. Brot. 2(59): 233-243.
TreeOfSex · plant — Goldblatt1979 ↗
2n 427×GoaT · Tree of Sex Database · CCDB · fl-europaea · CCDB · poland +3
GoaT · Tree of Sex Database — ↗
CCDB · fl-europaea — Ehrendorfer, ined.
CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.
CCDB · book-indian_vol1 — Piotrowicz, M (Skalinska, M. et al. 1959)
CCDB · Cave1959 — Skalinska. et al. 1959
CCDB · CromoCat 2015 — Ehrendorfer, F. (1982). Flora Europaea Check-list and Chromosome Index. In D.M. Moore. Pp. 168-173, 221-222. Cambridge Univ. Press. Cambridge.
CCDB · CromoCat 2015 — Skalinska, M., R., Czapik R. & M. Piotrowicz. (1959). Further studies in chromosome numbers of Polish angiosperms (Dicotyledons). Acta Soc. Bot. Poloniae 28(3): 487-529
2n 445×CCDB · ita-fl · CCDB · fl-europaea · CCDB · book-indian_vol1 +2
CCDB · ita-fl — COLOMBO P., MARCEN C., PRINCIOTTA R. - 1983. Numeros cromosomaticos de plantas occidentales, 200-210.. Anales Jard. Bot. Madrid , 39(2): 519-524.
CCDB · fl-europaea — Kliphuis, 1962b
CCDB · book-indian_vol1 — Homeyer, H. 1935; Lewis, W.H. 1962b
CCDB · Cave1962 — Lewis 1962d
CCDB · CromoCat 2015 — Colombo, P., Marcenó, C. & Princiotta, R. (1983a). Números cromosomáticos de plantas occidentales, 200-210. Anales Jard. Bot. Madrid 39: 519-524.
2n 482×CCDB · fl-europaea · CCDB · CromoCat 2015
CCDB · fl-europaea — Ehrendorfer, ined.
CCDB · CromoCat 2015 — Ehrendorfer, F. (1982). Flora Europaea Check-list and Chromosome Index. In D.M. Moore. Pp. 168-173, 221-222. Cambridge Univ. Press. Cambridge.
2n 622×CCDB · fl-europaea · CCDB · CromoCat 2015
CCDB · fl-europaea — Ehrendorfer, ined.
CCDB · CromoCat 2015 — Ehrendorfer, F. (1982). Flora Europaea Check-list and Chromosome Index. In D.M. Moore. Pp. 168-173, 221-222. Cambridge Univ. Press. Cambridge.
2n 682×CCDB · fl-europaea · CCDB · CromoCat 2015
CCDB · fl-europaea — Ehrendorfer, ined.
CCDB · CromoCat 2015 — Ehrendorfer, F. (1982). Flora Europaea Check-list and Chromosome Index. In D.M. Moore. Pp. 168-173, 221-222. Cambridge Univ. Press. Cambridge.
2n 862×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Fagerlind, F. (1934). Beiträge zur Kenntnis der Zytologie der rubiaceen. Hereditas 19: 223-232.
CCDB · CromoCat 2015 — Fagerlind, F. (1937). Embryologische, zytologische und bestäubungs experimentelle Studien in der Familie Rubiaceae nebst Bemerkungen über einige Polyploiditätsprobleme. Acta Horti Berg. 11: 195-470.
2n 631×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1963). Chromosome numbers of flowering plants in the Netherlands. Acta Bot. Neerl. 12(2): 195-230.
n 114×CCDB · ipcn-api-dl · CCDB · CromoCat 2015 · TreeOfSex · plant
CCDB · ipcn-api-dl — Sidhu, M., S. S. Bir & P. Lata. 1983. In IOPB chromosome number reports LXXIX. Taxon 32: 322.
CCDB · ipcn-api-dl — KLIPHUIS, E. 1980. Cytotaxonomic studies on Galium aparine L. Proc. Kon. Ned. Akad. Wetensch., C 83: 53–64.
CCDB · CromoCat 2015 — Sidhu, M., S.S. Bir & P. Lata. (1983). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIX]. Taxon 32(2): 322.
TreeOfSex · plant — Goldblatt1979 ↗
n 334×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Moore, D. M. 1981. Cromosome numbers of Fuegian angiosperms. Bol. Soc. Brot. 53: 995–1012.
CCDB · ipcn-api-dl — Donneaux, A. 1981. Contribution a l'etude cytotaxonomique du genre Galium L. s.l. (Rubiaceae) en Belgique et dans les regions voisines. Lejeunia 103: 1–74.
CCDB · CromoCat 2015 — Donneaux, A. (1981). Contribution à l'étude cytotaxonomique du genre Galium L. s. l. (Rubiaceae) en Belgique et dans les régions voisines Lejeunia 103: 1-75.
CCDB · CromoCat 2015 — Moore, D. M. (1981). Cromosome numbers of Fuegian angiosperms. Boletim da Sociedade Broteriana 53: 995-1012
n 322×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Spooner, D. M., T. F. Stuessy, D. J. Crawford & M. Silva. 1987. Chromosome numbers from the flora of the Juan Fernandez Islands. II. Rhodora 89: 351–356.
CCDB · CromoCat 2015 — Spooner, D. M., T. F. Stuessy, D. J. Crawford & O. M. Silva. (1987). Chromosome numbers from the flora of the Juan Fernández islands. II. Rhodora 89: 351-356.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness96.2% BUSCO
07Deep time~9.98 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin9.98 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type1 011 852 records
Wild obs. + sensor979 063
Museum / vouchered28 247
Cultivated / captive533
Fossil2
Other4 007
Origin
Native56 175
Introduced7 186
Range
Area of Occupancy AOO811 168 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy50% within 1 km
≤100 m 214 180≤1 km 194 116≤10 km 406 430>10 km 6 381
821 107 georeferenced · 157 956 without coordinates
Open the mapobservation + sensor979 063
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 1 665≤1 km 6 677≤10 km 10 998>10 km 579
19 919 georeferenced · 8 328 without coordinates
Open the institutions mapphysical evidence28 247
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy7% within 1 km
≤100 m 2≤10 km 7>10 km 21
30 georeferenced · 503 without coordinates
Open the mapnot free-living533
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions255 of 457 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 11 998 |
| BFLlocation not on record | 645 |
| BIO-UNIPIlocation not on record | 577 |
| Berlin, DE | 544 |
| LDlocation not on record | 394 |
| Philadelphia, US | 356 |
| Olocation not on record | 352 |
| San Diego, US | 343 |
| Chongqing Museumlocation not on record | 330 |
| Madison, US | 307 |
| Claremont, US | 286 |
| Moscow State Universitylocation not on record | 261 |
| Riverside, US | 238 |
| Wuzhou, CN | 232 |
| Bronx, US | 231 |
| Santa Barbara, US | 202 |
| St. Paul, US | 181 |
| WTUlocation not on record | 174 |
| Bloomington, US | 171 |
| Pullman, US | 167 |
| Uppsala, SE | 166 |
| ASUlocation not on record | 157 |
| Bergen, NO | 155 |
| MeiseBGlocation not on record | 148 |
| Provincia di Livornolocation not on record | 147 |
| Corvallis, US | 141 |
| Salzburg, AT | 137 |
| Beijing, CN | 137 |
| Trondheim, NO | 136 |
| Fort Worth, US | 131 |
| Uniwersytet Warszawskilocation not on record | 115 |
| SLU Artdatabankenlocation not on record | 115 |
| Davis, US | 112 |
| TROMlocation not on record | 110 |
| Turku, FI | 110 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 106 |
| Arcata, US | 106 |
| Saint Louis, US | 105 |
| Oskarshamn, SE | 100 |
| Moscow, US | 100 |
| Angwin, US | 99 |
| MAlocation not on record | 96 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 94 |
| Ann Arbor, US | 91 |
| San Luis Obispo, US | 90 |
| Museo Entomologico de Leonlocation not on record | 87 |
| Austin, US | 85 |
| València, ES | 82 |
| Barcelona, ES | 81 |
| Wuhan, CN | 81 |
| QAUlocation not on record | 78 |
| Entomological Society of Latvialocation not on record | 77 |
| CICYTEXlocation not on record | 72 |
| Görlitz, DE | 72 |
| Adelaide, AU | 71 |
| Canadian Department of Agriculturelocation not on record | 68 |
| Adam Mickiewicz University in Poznańlocation not on record | 65 |
| Green Bay, US | 65 |
| Mount Annan, AU | 64 |
| BDBClocation not on record | 64 |
| University of Stellenboschlocation not on record | 62 |
| Flagstaff, US | 62 |
| College Park, US | 61 |
| Boise, US | 60 |
| Phoenix, US | 60 |
| US | 60 |
| Emporia, US | 59 |
| Wlocation not on record | 59 |
| Tartu, EE | 59 |
| KMNlocation not on record | 58 |
| Chadron, US | 57 |
| Denver, US | 54 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 53 |
| Williamsburg, US | 52 |
| Auckland, NZ | 50 |
| Madrid, ES | 50 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 50 |
| Pittsburg, US | 48 |
| Canberra, AU | 48 |
| BAYLUlocation not on record | 44 |
| Bern, CH | 44 |
| Toronto, CA | 43 |
| ISAlocation not on record | 43 |
| Oulu, FI | 43 |
| Vitoria, ES | 43 |
| South Kensington, GB | 42 |
| Bangkok, TH | 41 |
| Burlington, US | 41 |
| Bozeman, US | 38 |
| CASlocation not on record | 37 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 36 |
| BRNUlocation not on record | 35 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 35 |
| Irvine, US | 35 |
| Mlocation not on record | 35 |
| New Haven, US | 33 |
| Pocatello, US | 33 |
| Provo, US | 32 |
| Salamanca, ES | 32 |
| College of the Atlantic, Museumlocation not on record | 31 |
| Hobart, AU | 31 |
| McWane Science Centerlocation not on record | 30 |
| Albuquerque, US | 30 |
| Allentown, US | 30 |
| Logan, US | 30 |
| Missoula, US | 29 |
| Karlsruhe, DE | 29 |
| Christchurch, NZ | 29 |
| BClocation not on record | 29 |
| Jena Microbial Resource Collectionlocation not on record | 27 |
| Garðabær, IS | 27 |
| Chicago, US | 26 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 26 |
| Badajoz, ES | 25 |
| Jackson, US | 25 |
| Tuscaloosa, US | 25 |
| Severin-McDaniel Insect Collectionlocation not on record | 24 |
| TUR-Alocation not on record | 24 |
| Wellington, NZ | 23 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 23 |
| Kew, GB | 22 |
| Córdoba, ES | 22 |
| UIBlocation not on record | 22 |
| Brisbane, AU | 22 |
| Chapel Hill, US | 22 |
| EL PASO, US | 21 |
| University of New Hampshirelocation not on record | 21 |
| Granada, ES | 21 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 20 |
| Caldwell, US | 20 |
| CJBGlocation not on record | 20 |
| Portland, US | 20 |
| Pamplona, ES | 20 |
| Spearfish, US | 20 |
| Long Beach, US | 19 |
| Vancouver, CA | 19 |
| Morgantown, US | 19 |
| Ashland, US | 19 |
| GB | 18 |
| Lincoln, US | 18 |
| Fayetteville, US | 18 |
| Victoria, CA | 18 |
| Cheney, US | 17 |
| Acadia Universitylocation not on record | 17 |
| Tallinn, EE | 17 |
| Tampa, US | 16 |
| Knoxville, US | 16 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 16 |
| Québec, CA | 15 |
| Millersville, US | 15 |
| Dekalb, US | 15 |
| Kensington, AU | 15 |
| GAlocation not on record | 15 |
| Paris, FR | 15 |
| UChlocation not on record | 15 |
| Jyväskylä, FI | 14 |
| Saint John, CA | 14 |
| Columbia, US | 14 |
| Davenport, US | 14 |
| Frankfurt am Main | 14 |
| GJOlocation not on record | 14 |
| Sendai, JP | 14 |
| US | 14 |
| Santa Cruz, US | 14 |
| Norfolk, US | 13 |
| Los Angeles, US | 13 |
| Northridge, US | 13 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 13 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 13 |
| San Angelo, US | 12 |
| Rotorua, NZ | 12 |
| Johnson City, US | 12 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 12 |
| San Francisco, US | 12 |
| Rishon Le Zion, IL | 11 |
| Valparaiso, CL | 11 |
| Little Rock, US | 11 |
| Guangzhou, CN | 11 |
| Helsinki, FI | 11 |
| Durham, US | 11 |
| Whitewater, US | 11 |
| Guilin, CN | 11 |
| Armidale, AU | 10 |
| New Brunswick, US | 10 |
| Uniwersytet Śląski w Katowicachlocation not on record | 10 |
| Uniwersytet Opolskilocation not on record | 10 |
| Chicago, US | 10 |
| Kirksville, US | 10 |
| Phyletisches Museum Jenalocation not on record | 10 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 10 |
| Tilburg, NL | 9 |
| Tacoma, US | 9 |
| Waverly, US | 9 |
| Museum of the Rockieslocation not on record | 9 |
| Tula State Universitylocation not on record | 9 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 9 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 9 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 9 |
| Denton, US | 9 |
| Natural History Museum Rotterdamlocation not on record | 9 |
| Museo Achille Folettolocation not on record | 9 |
| Texas Lutheran Universitylocation not on record | 9 |
| Staten Island, US | 9 |
| Stockholm, SE | 9 |
| Zürich, CH | 9 |
| Catalina Island Conservancylocation not on record | 8 |
| Odawara, JP | 8 |
| Keene State Universitylocation not on record | 8 |
| Fairfax, US | 8 |
| Alicante, ES | 8 |
| Chicago, US | 8 |
| Porrentruy, CH | 8 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 8 |
| Miami, US | 8 |
| AUAlocation not on record | 7 |
| Pamplona, ES | 7 |
| PrivatHerblocation not on record | 7 |
| Bend, US | 7 |
| Royal Botanical Gardenslocation not on record | 7 |
| Henderson, US | 7 |
| Porvoo, FI | 7 |
| Weber State Universitylocation not on record | 7 |
| Lord Fairfax Community Collegelocation not on record | 7 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 7 |
| Tempe, US | 7 |
| Turlock, US | 7 |
| China Agricultural Universitylocation not on record | 7 |
| San Isidro, AR | 7 |
| SZUlocation not on record | 7 |
| Dehra Dun, IN | 7 |
| US | 6 |
| OLAlocation not on record | 6 |
| Eastern Nevada Landscape Coalitionlocation not on record | 6 |
| Taipei, TW | 6 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 6 |
| Zürich, CH | 6 |
| Valdosta State Universitylocation not on record | 6 |
| UGentlocation not on record | 6 |
| Edinburgh, GB | 6 |
| Kathmandu, NP | 6 |
| Washington, US | 6 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 6 |
| Kuopio, FI | 6 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 6 |
| LfUlocation not on record | 6 |
| Hermosillo, MX | 5 |
| University of Guelph, OAC Herbariumlocation not on record | 5 |
| Chengdu, CN | 5 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 5 |
| Kawasaki Shi Tama Ku, JP | 5 |
| John May Museum of Natural Historylocation not on record | 5 |
| Springfield, US | 5 |
| Coimbra, PT | 5 |
| Sagamihara, JP | 5 |
| Dover, US | 5 |
| Université Lavallocation not on record | 5 |
| Jaén, ES | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| PRClocation not on record | 5 |
| Fredericton Stock Culture Collectionlocation not on record | 5 |
| IDElocation not on record | 5 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Ciudad de México, MX | 4 |
| Clemson, US | 4 |
| EEZA-CSIClocation not on record | 4 |
| Fargo, US | 4 |
| University of Southern Mississippilocation not on record | 4 |
| Umeå Universitylocation not on record | 4 |
| Stephenville, US | 4 |
| Fulda, DE | 4 |
| Elocation not on record | 4 |
| Philadelphia, US | 4 |
| Göteborg, SE | 4 |
| Conway, US | 4 |
| Mexico City, MX | 4 |
| nbflocation not on record | 4 |
| Richmond, US | 4 |
| Hudson, US | 4 |
| DBF-NHMDlocation not on record | 4 |
| Xiamen, CN | 4 |
| Lubbock, US | 4 |
| Edmonton, CA | 3 |
| National Botanic Garden of Waleslocation not on record | 3 |
| Montréal, CA | 3 |
| Castelar, AR | 3 |
| JBSlocation not on record | 3 |
| US | 3 |
| University of Tennessee at Chattanoogalocation not on record | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Inner Mongolia Universitylocation not on record | 3 |
| Kunming, CN | 3 |
| Kushiro City Museumlocation not on record | 3 |
| HJAEFlocation not on record | 3 |
| Mississippi State, US | 3 |
| NMBU:MINAlocation not on record | 3 |
| WINlocation not on record | 3 |
| Anchorage, US | 3 |
| VALElocation not on record | 3 |
| Orem, US | 3 |
| Whitehorse, CA | 3 |
| Cusco, PE | 3 |
| Kingston, US | 3 |
| Meguro Parasitological Museumlocation not on record | 3 |
| Jefferson City, US | 3 |
| Laboratory of Palaeontologylocation not on record | 3 |
| KNFHClocation not on record | 3 |
| Durango, MX | 3 |
| München, DE | 3 |
| Córdoba, AR | 3 |
| BSBIlocation not on record | 3 |
| Servico de Microbiologia e Imunologialocation not on record | 3 |
| San Bernardino, US | 3 |
| Smithsonian Institutionlocation not on record | 3 |
| Batemans Bay, AU | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| La Paz, MX | 3 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 3 |
| ESP109location not on record | 3 |
| Mohonk Preservelocation not on record | 3 |
| Tromso University Museumlocation not on record | 3 |
| Palmerston North, NZ | 2 |
| Philadelphia, US | 2 |
| Viña del Mar, CL | 2 |
| Winterthur, CH | 2 |
| Seropédica, BR | 2 |
| San Jose, US | 2 |
| Decorah, US | 2 |
| Durango, US | 2 |
| University of Alberta Museumslocation not on record | 2 |
| Tall Timbers Research Stationlocation not on record | 2 |
| TAIElocation not on record | 2 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 2 |
| Firenze, IT | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| Calabar, NG | 2 |
| Finnish Museum of Natural Historylocation not on record | 2 |
| KNFYlocation not on record | 2 |
| STNFlocation not on record | 2 |
| Salvador, BR | 2 |
| Bourges, FR | 2 |
| UFRRJlocation not on record | 2 |
| Glarus, CH | 2 |
| Dresden, DE | 2 |
| Pondicherry, IN | 2 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 2 |
| GZUlocation not on record | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Valparaíso, CL | 2 |
| Wollongong, AU | 2 |
| H-Schuhwlocation not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| Sion, CH | 2 |
| LINUlocation not on record | 2 |
| Beijing Normal Universitylocation not on record | 2 |
| Omachi Alpine Museumlocation not on record | 2 |
| J. Rusek Collectionlocation not on record | 2 |
| Walla Walla, US | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Macomb, US | 2 |
| La Paz, BO | 2 |
| Buenos Aires, AR | 2 |
| Seoul, KR | 2 |
| Brookings, US | 2 |
| Nagano City, JP | 2 |
| Rovaniemi, FI | 2 |
| Podgorica, ME | 2 |
| Giardini Botanici Hanburylocation not on record | 2 |
| Namur, BE | 2 |
| Mount Pleasant, US | 1 |
| IPA/SPlocation not on record | 1 |
| University of Patraslocation not on record | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Monastir, TN | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Montréal, CA | 1 |
| SWlocation not on record | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Nijmegen, NL | 1 |
| Post Graduate College Bannulocation not on record | 1 |
| BISHlocation not on record | 1 |
| Museo civico di Ecologia e Storia naturale di Marano sul Panarolocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| Conway, US | 1 |
| WAGlocation not on record | 1 |
| Memorial University of Newfoundlandlocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| Xinxiang, CN | 1 |
| DASSHlocation not on record | 1 |
| Cochabamba, BO | 1 |
| AASlocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| USFS/BHSClocation not on record | 1 |
| TADlocation not on record | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| Arequipa, PE | 1 |
| HUFDlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Universidad Nacional de Cajamarcalocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| Tomioka, JP | 1 |
| Pretoria, ZA | 1 |
| HUPCHlocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| CJBNlocation not on record | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| NSW Office of Environment and Heritagelocation not on record | 1 |
| QVMAGlocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Parkville, AU | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Cambridge, US | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Berea Collegelocation not on record | 1 |
| 1 | |
| Dhaka, BD | 1 |
| Sevilla, ES | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Stockholm, SE | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
| Lausanne, CH | 1 |
| Ypsilanti, US | 1 |
| JBRJlocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Universität Göttingenlocation not on record | 1 |
| Honolulu, US | 1 |
| Frauenfeld, CH | 1 |
| Fukushima Universitylocation not on record | 1 |
| USFSlocation not on record | 1 |
| Taipei, TW | 1 |
| KNFSClocation not on record | 1 |
| La Trobe Universitylocation not on record | 1 |
| CIBIOlocation not on record | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| Grand Junction, US | 1 |
| FLADlocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| Ensenada, MX | 1 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 1 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Feira de Santana, BR | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Oswego, US | 1 |
| Banyoles, ES | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Shanghai, CN | 1 |
| Zhejiang Universitylocation not on record | 1 |
| University of Lethbridgelocation not on record | 1 |
| Palmerston, AU | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
457 institutions · 26 442 of 28 247 vouchered records shown · 1 464 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA183 detections
Where the DNA of Galium aparine was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found183
Studies independent surveys6
Countries17
Verifiable raw sequence linked3
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 183 detections have coordinates
Open the map17 countries0
non-native annual grassland (rangeland) with…Palearctic
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Measured at samplingin-field
Temperature19.5 °C 11.0–24.0
pH5.80 4.40–8.80
Conductivity55.0 µS/cm 13.0–2,129
Organic carbon2.67 % 0.19–5.83
Water content16.3 % 4.07–50.8
Nitrate-N8.00 mg/kg 1.00–106
Phosphorus21.0 mg/kg 3.00–77.0
Clay14.5 % 0.445–58.6
Sand67.8 % 15.1–96.1
Depth0 m 0–0.2
SoilKurosolTenosolVertosolKurosolsChromosolsTenosols
95 samples with on-site data · median with range · describes the sample, not the organism
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.9 °C 4.80–17.6
Seasonal swing summer↔winter14.0 °C
Max temp (day)18.6 °C 8.70–22.4
Min temp (night)8.80 °C 0.9–14.6
Precipitation65.1 mm/mo 43.5–95.4
Air humidity59.2 % 55.6–65.3
Moisture balance-34.0 mm/mo -101–53.8
Vapour deficit656 Pa 284–828
Wind speed3.30 m/s 2.10–5.60
Cloud cover25.4 % 20.5–48.3
CHELSA 1981–2010, ~9 km grid, at location & month of 143 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.