Galium album
Mill. · speciesAt a glance
Occurrence records257 414
Data sources13
Biological traits40
DNA specimens6
eDNA detections4
Sources13 archives
Databases and archives Galium album's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility257 414 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics6 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources40 traits
Chemical compositionLOTUS · NPASS69 compounds
Occurrence & distributionGBIF257 414 records
Environmental DNA1 datasets · 2 countries4 detections
DNA & barcodingBOLD · NCBI6 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex1.8 Gbp
01Narrative
Le Gaillet blanc (Galium album) est une plante herbacée vivace de la famille des Rubiacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVPAusTraits
Size & morphology10
Leaf size35.4 mm²
⚠ sources differ — TRY: 35.4 mm² · GIFT: 58.5 mm²
Plant height0.875 m
⚠ sources differ — GIFT: 0.875 m · LEDA: 0.875 m · TRY: 0.58 m
Plant height generative0.7 m
Plant height max1 m
Plant height min0.1 m
Seed length1.5 mm
Seed mass0.72 mg
⚠ sources differ — TRY: 0.72 mg · LEDA: 0.526 mg · GIFT: 0.526 mg
Seed volume0.82 mm³
Seed volume max0.82 mm³
Seed volume min0.82 mm³
Life cycle & reproduction12
Deciduousnessaestival
Dispersal typeanimal
Flowering endAug
Flowering startJun
Life formperennial
Life spanperennial
Lifespan years4 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit fleshinessdry
Growth formherb
Habitat GIFTcrop fields, meadows: dry, roadsides
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf c453 mg/g
Leaf dry-matter content (LDMC)231 mg/g
Leaf n21.02 mg/g
Leaf p2.32 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)24.13 mm²/mg
Other traits1
Diaspore typegenerative dispersule
03Chemical composition69 compounds
Compounds documented for Galium album across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Dibenzylbutyrolactone lignans19
Iridoids monoterpenoids13
Simple coumarins6
Secoiridoid monoterpenoids5
Flavones3
Documented compounds69 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Pinoresinol | present | NPASS | |
| (-)-(7R,8R,8'R)-acuminatolide | present | NPASS | |
| (-)-Matairesinol | present | NPASS | |
| (3E,4R)-4-(1,3-benzodioxol-5-ylmethyl)-3-[(3-hydroxy-4-methoxyphenyl)methylidene]oxolan-2-one | present | NPASS | |
| (3R,4R)-3-[(3,4-dimethoxyphenyl)methyl]-4-[(4-hydroxy-3-methoxyphenyl)methyl]oxolan-2-one | present | NPASS | |
| (3R,4R)-4-(1,3-benzodioxol-5-ylmethyl)-3-[(3-hydroxy-4-methoxyphenyl)methyl]oxolan-2-one | present | NPASS | |
| (3R,4R)-4-[(3,4-dihydroxyphenyl)methyl]-3-[(3,4-dimethoxyphenyl)methyl]oxolan-2-one | present | NPASS | |
| (3R,4R)-4-[(3-hydroxy-4-methoxyphenyl)methyl]-3-[(4-hydroxy-3-methoxyphenyl)methyl]oxolan-2-one | present | NPASS | |
| (3R,4R)-4-[(4-hydroxy-3,5-dimethoxyphenyl)methyl]-3-[(4-hydroxy-3-methoxyphenyl)methyl]oxolan-2-one | present | NPASS | |
| (3R,4S)-4-(1,3-benzodioxol-5-ylmethyl)-3-[(3,4-dimethoxyphenyl)methyl]-3-hydroxyoxolan-2-one | present | NPASS |
05DNA & barcoding6 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galium album has left across the world's sequence archives.
At a glance
DNA specimens6
Marker genes3
GenBank sequences6
eDNA detections4
Countries4
The DNA barcodea real sequence read deposited for this species
GTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAGCGACCGCGAACACGTTAAACAAAAATCGCGGGGCGCCGGCCGGACCTAA …
Galium album genomic DNA sequence contains 18S rRNA gene, ITS1, 5.8S rRNA gene, ITS2, isolate IS659, specimen voucher G. Morante & J. A. Alejandre 3012-83
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL4★ITS1
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Galium album carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 828 860 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Galium album1.83 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 44 n = 22
Ploidy4× tetraploid · measured
Chromosome records22–442n range44median44mode89records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4484×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +10
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · slov-fl — Murín A. & Záborský J., 1976: [Report], pp. 489. - In: Löve Á. (ed.), IOPB Chromosome number reports LIII, Taxon 25 /4.
CCDB · slov-fl — Michalková E., 1991: Výsledky štúdia počtov chromozómov Galium mollugo agg. na Slovensku. - Biologia (Bratislava) 46/9: 799-810.
CCDB · iber-fl — Notas cariolgicas em Rubiaceae portuguesas. Queirs, M.Bol. Soc. Brot. ser. 259: 233-243(1987).
CCDB · iber-fl — Cytotaxonomic studies on the genus Galium L. Notes on some species occurring in Portugal. Kliphuis, E.Mem. Soc. Brot.27: 77-87(1984).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3786
CCDB · fl-europaea — Ancev, 1974
CCDB · fl-europaea — Ehrendorfer &
CCDB · ipcn-api-dl — Queirós, M. 1987. Notas cariológicas em Rubiaceae Portuguesas. Bol. Soc. Brot., sér. 2 59: 233–243.
CCDB · ipcn-api-dl — Queirós, M. 1986. Notas cariológicas em Rubiaceae Portuguesas. Bol. Soc. Brot., sér. 2 59: 233–243.
CCDB · ipcn-api-dl — Anchev, M. E. 1982a. Taxonomic study of Galium L. in Bulgaria. II. Karyological and pollen structural investigation. Fitologija 19: 43–68. (In Bulgarian).
CCDB · ipcn-api-dl — KLIPHUIS, E. 1986. Cytotaxonomic investigations on some species of the genus Galium (Rubiaceae) from the Balcans. Nordic J. Bot. 6: 15–20.
CCDB · ipcn-api-dl — KLIPHUIS, E. 1984. Cytotaxonomic studies on the genus Galium L. Notes on some species occurring in Portugal. Mem. Soc. Brot. 27: 77–87.
CCDB · ipcn-api-dl — KLIPHUIS, E. 1983. Cytotaxonomic notes on some species of the genus Galium L. (Rubiaceae) collected in the North-western parts of Spain. Lagascalia 11: 229–244.
CCDB · ipcn-api-dl — Michalková, E. 1991. Results of the study of the chromosome numbers of Galium mollugo agg. in Slovakia. Biologia (Bratislava) 46: 799–810.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Ehrendorfer, F. & F. Krendl. 1982. In D.M. Moore, Flora Europaea Check-list and Chromosome Index.Cambridge Univ. Press. P. 170.
CCDB · ipcn-api-dl — Montgomery, L., M. Khalaf, J. P. Bailey & K. J. Gornal. 1997. Contributions to a cytological catalogue of the British and Irish flora, 5. Watsonia 21: 365–368.
CCDB · ipcn-api-dl — Krendl, F. 1987. Die arten der Galium mollugo--gruppe in Griechenland. Bot. Chron. (Patras) 6–7: 5–168.
CCDB · book-ipcn67-71 — FRENDL, F. 1967. Cytotaxonomie der Galium mollugo-Gruppe in Mitteleuropa. Oesterr. Bot. z. 114: 508-549.
CCDB · book-ipcn67-71 — KRENDL, F. 1967. Cytotaxonomie der Galium mollugo-Gruppe in Mitteleuropa. (Zur phylogenie der Gattung Galium, VIII.) osterr. Bot. Zeit. 114: 508-549. ----
CCDB · book-ipcn75-78 — Murin & Zaborsky 1976
CCDB · book-ipcn75-78 — Murin 1974
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-ipcn73-74 — ANCEV, M.E. 1974. In IOPB chromosome number reports XLIV. Taxon 23: 373-380.
CCDB · kew — Temsch EM, Temsch W, Ehrendorfer-Schratt L, Greilhuber J. 2010. Heavy metal pollution, selection, and genome size: The species of the Žerjav study revisited with flow cytometry. Journal of Botany 2010: Article ID 596542, 11 pages.
CCDB · CromoCat 2015 — Albers, F. & Pröbsting, W. (1998). In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart
CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.
CCDB · CromoCat 2015 — Lövkvist, B. & Hultgård, U.-M. (1999). Chromosome numbers in south Swedish vascular plants Opera botanica 137: 1-42
CCDB · CromoCat 2015 — Michalková, E. (1991). Results of the study of the chromosome numbers of Galium mollugo agg. in Slovakia Biologia 46: 799-810
CCDB · CromoCat 2015 — Murín, A. & J. Záborský. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIII]. Taxon 25(4): 489.
CCDB · CromoCat 2015 — Krendl, F. (1966). Zur Phytologie der Gattung Galium, VIII. Cytotaxonomie der Galium mollugo-Gruppe in Mittleleuropa. Diss. Universität Wien pp. 95+IV
CCDB · CromoCat 2015 — Ancev, M. E. (1974a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLIV]. Taxon 23(2/3): 374-375.
CCDB · CromoCat 2015 — Kliphuis, E. (1986). Cytotaxonomic investigations on some species of the genus Galium (Rubiaceae) from the Balkans. Nord. J. Bot. 6: 15-20.
CCDB · CromoCat 2015 — Ancev, M. E. (1978b). Taxonomicno proucvane na rod Galium L.v. Bulgarija V. Evoljucija na cvetnite rastenija i florogenez 1: 107-147.
CCDB · CromoCat 2015 — Kliphuis, E. (1983). Cytotaxonomic notes on some species of the genus Galium L. (Rubiaceae) collected in the North-Western parts of Spain. Lagascalia 11: 229-244.
+5 more references
2n 225×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
GoaT · Tree of Sex Database — ↗
CCDB · ipcn-api-dl — Papanicolaou, K. 1984. Chromosome Number Reports LXXXII. Taxon 33: 126–134.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · CromoCat 2015 — Papanicolaou, K. (1984). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXXII]. Taxon 33(1): 130-131.
CCDB · CromoCat 2015 — Strid, A. & R. Franzén. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 829-842.
n 229×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · CromoCat 2015 +1
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · book-ipcn67-71 — FRENDL, F. 1967. Cytotaxonomie der Galium mollugo-Gruppe in Mitteleuropa. Oesterr. Bot. z. 114: 508-549.
CCDB · book-ipcn67-71 — KRENDL, F. 1967. Cytotaxonomie der Galium mollugo-Gruppe in Mitteleuropa. (Zur phylogenie der Gattung Galium, VIII.) osterr. Bot. Zeit. 114: 508-549. ----
CCDB · CromoCat 2015 — Krendl, F. (1966). Zur Phytologie der Gattung Galium, VIII. Cytotaxonomie der Galium mollugo-Gruppe in Mittleleuropa. Diss. Universität Wien pp. 95+IV
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
CCDB · CromoCat 2015 — Krendl, F. (1967). Cytotaxonomie der Galium mollugo Gruppe in Mitteleuropa. (Zur phylogenie der Gattung Galium, VIII.). Österr. Bot. Z. 114: 508-549.
TreeOfSex · plant — Goldblatt1979 ↗
n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kliphuis, E. (1986). Cytotaxonomic investigations on some species of the genus Galium (Rubiaceae) from the Balkans. Nord. J. Bot. 6: 15-20.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type257 414 records
Wild obs. + sensor251 346
Museum / vouchered4 769
Cultivated / captive2
Other1 297
Origin
Native19 016
Introduced94
Range
Area of Occupancy AOO279 992 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy42% within 1 km
≤100 m 42 527≤1 km 49 761≤10 km 126 772>10 km 627
219 687 georeferenced · 31 659 without coordinates
Open the mapobservation + sensor251 346
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy45% within 1 km
≤100 m 550≤1 km 1 082≤10 km 1 923>10 km 94
3 649 georeferenced · 1 120 without coordinates
Open the institutions mapphysical evidence4 769
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 2 records without
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions59 of 107 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 099 |
| Olocation not on record | 498 |
| Salzburg, AT | 417 |
| Provincia di Livornolocation not on record | 346 |
| Oulu, FI | 279 |
| BFLlocation not on record | 212 |
| Trondheim, NO | 172 |
| Görlitz, DE | 124 |
| TROMlocation not on record | 90 |
| Jyväskylä, FI | 86 |
| Kuopio, FI | 85 |
| Turku, FI | 76 |
| Moscow State Universitylocation not on record | 55 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 44 |
| Tallinn, EE | 43 |
| GJOlocation not on record | 41 |
| Berlin, DE | 40 |
| South Kensington, GB | 37 |
| Tartu, EE | 37 |
| KMNlocation not on record | 36 |
| Madison, US | 33 |
| BRNUlocation not on record | 31 |
| Mlocation not on record | 28 |
| CICYTEXlocation not on record | 18 |
| Burlington, US | 18 |
| Salamanca, ES | 18 |
| Wlocation not on record | 17 |
| CJBGlocation not on record | 17 |
| Uppsala, SE | 16 |
| Frankfurt am Main | 16 |
| Helsinki, FI | 16 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 15 |
| Porvoo, FI | 14 |
| BSBIlocation not on record | 13 |
| Bern, CH | 12 |
| LfUlocation not on record | 12 |
| Ann Arbor, US | 11 |
| TUR-Alocation not on record | 11 |
| Philadelphia, US | 10 |
| Karlsruhe, DE | 10 |
| Barcelona, ES | 10 |
| Zürich, CH | 9 |
| Bergen, NO | 9 |
| MAlocation not on record | 8 |
| Fulda, DE | 8 |
| Bronx, US | 8 |
| College of the Atlantic, Museumlocation not on record | 8 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 8 |
| Sevilla, ES | 7 |
| H-Schuhwlocation not on record | 6 |
| València, ES | 6 |
| Entomological Society of Latvialocation not on record | 5 |
| Rovaniemi, FI | 5 |
| Paris, FR | 4 |
| McWane Science Centerlocation not on record | 4 |
| Zürich, CH | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| BIO-UNIPIlocation not on record | 4 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 3 |
| Toronto, CA | 3 |
| Chongqing Museumlocation not on record | 3 |
| nbflocation not on record | 3 |
| Forssa, FI | 2 |
| Granada, ES | 2 |
| PrivatHerblocation not on record | 2 |
| St. Paul, US | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| GZUlocation not on record | 2 |
| Gijón, ES | 2 |
| Frauenfeld, CH | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| MeiseBGlocation not on record | 2 |
| Montréal, CA | 2 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Edinburgh, GB | 1 |
| Durham, US | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Alicante, ES | 1 |
| Saint Louis, US | 1 |
| SZUlocation not on record | 1 |
| Bourges, FR | 1 |
| Xiamen, CN | 1 |
| H-Hohlalocation not on record | 1 |
| Tilburg, NL | 1 |
| LUXEMBOURG, LU | 1 |
| Green Bay, US | 1 |
| UNINE:NEUlocation not on record | 1 |
| Pamplona, ES | 1 |
| Beijing, CN | 1 |
| Jaén, ES | 1 |
| Macomb, US | 1 |
| Madrid, ES | 1 |
| BGBMlocation not on record | 1 |
| University of New Hampshirelocation not on record | 1 |
| Herb. BBGlocation not on record | 1 |
| DULlocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| Kew, GB | 1 |
| Mount Annan, AU | 1 |
| Hobart, AU | 1 |
| Göteborg, SE | 1 |
| New Brunswick, US | 1 |
| BioFokuslocation not on record | 1 |
| WTUlocation not on record | 1 |
| FLADlocation not on record | 1 |
| Porrentruy, CH | 1 |
107 institutions · 4 339 of 4 769 vouchered records shown · 349 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA4 detections
Where the DNA of Galium album was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found4
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 4 detections have coordinates
Open the map2 countries0
on sandy soil next to path
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median7.70 °C 3.50–11.8
Seasonal swing summer↔winter18.0 °C
Max temp (day)10.0 °C 6.20–13.9
Min temp (night)4.80 °C 0.4–9.20
Precipitation61.6 mm/mo 61.1–62.1
Air humidity63.4 % 61.8–65.0
Vapour deficit452 Pa 354–550
Cloud cover51.6 % 50.9–52.3
CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.