Galinsoga quadriradiata
Ruiz & Pav. · speciesAt a glance
Occurrence records132 195
Data sources14
Biological traits64
DNA specimens35
eDNA detections22
Sources14 archives
Databases and archives Galinsoga quadriradiata's data was compiled from.
WikipediaWikimedia Foundation2 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility132 195 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics35 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources64 traits
Chemical compositionLOTUS14 compounds
Occurrence & distributionGBIF132 195 records
Environmental DNA1 datasets · 9 countries22 detections
DNA & barcodingBOLD · NCBI35 specimens
Genome at a glanceCCDB · GIFT · GoaT1.9 Gbp
01Narrative
Das Behaarte Knopfkraut oder Behaarte Franzosenkraut (Galinsoga ciliata) ist eine Pflanzenart aus der Gattung Franzosenkräuter (Galinsoga) innerhalb der Familie der Korbblütler (Asteraceae). Im englischsprachigen Raum wird meistens das Synonym Galinsoga quadriradiata verwendet. Es gilt als häufiges „Unkraut“.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology19
Fruit length1 mm
Fruit length max1.5 mm
Fruit length min1.2 mm
Leaf length max70 mm
Leaf length min25 mm
Leaf mass19.08 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 639 mm² · GIFT: 1 102 mm²
Leaf width max50 mm
Leaf width min15 mm
Plant height0.318 m
⚠ sources differ — GIFT: 0.318 m · LEDA: 0.335 m · TRY: 0.3 m
Plant height generative0.225 m
Plant height max0.8 m
Plant height min0.1 m
Seed length1.4 mm
Seed length max1.4 mm
Seed length min1.4 mm
Seed mass0.233 mg
⚠ sources differ — TRY: 0.233 mg · LEDA: 0.174 mg · GIFT: 0.177 mg
Seed mass max0.27 mg
Seed mass min0 mg
Life cycle & reproduction18
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: anemochorous
Flower colourwhite
Flower width max7 mm
Flower width min4 mm
Flowering endSep
Flowering startJun
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number3 500
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max4 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTÁrea Antrópica
Leaf formovate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio14.76 g/g
Leaf c458 mg/g
Leaf dry-matter content (LDMC)138 mg/g
Leaf n32.47 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index1
Specific leaf area (SLA)31.87 mm²/mg
⚠ sources differ — TRY: 31.87 mm²/mg · LEDA: 34.34 mm²/mg · GIFT: 38.15 mm²/mg
Wood density97.45 mg/cm³
Other traits4
Diaspore typeone-seeded generative dispersule
Leaf arrangementopposite
Seeds per fruit101-1000
Shoot orientationascending
03Chemical composition14 compounds
Compounds documented for Galinsoga quadriradiata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols4
Simple phenolic acids3
Cinnamic acids and derivatives3
Cinnamic acids and derivatives $ Simple phenolic acids2
Simple coumarins2
Documented compounds14 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 2-(3,4-dihydroxyphenyl)-3,5-dihydroxy-7-[(2S,4S,5S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one | present | LOTUS | |
| 2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one | present | LOTUS | |
| 4-Hydroxybenzoic acid | present | LOTUS | |
| Aesculetin | present | LOTUS | |
| Centaurein | present | LOTUS | |
| Isovanillic Acid | present | LOTUS | |
| Patulitrin | present | LOTUS | |
| protocatechuate | present | LOTUS | |
| Scopoletin | present | LOTUS | |
| Syringic acid | present | LOTUS |
05DNA & barcoding35 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galinsoga quadriradiata has left across the world's sequence archives.
At a glance
DNA specimens35
Marker genes8
GenBank sequences10
eDNA detections22
Countries10
The DNA barcodea real sequence read deposited for this species
GTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGTTGAGGGCACGTCTGCCTGGGCGT …
Galinsoga quadriradiata isolate Peru170529 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL5★rbcLa★ITS3★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Galinsoga quadriradiata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 936 440 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Galinsoga quadriradiata1.94 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidy2× / 4× cytotypes
Chromosome records16–642n range32median32mode34records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3226×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · iapt +9
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · brit-fl — Haskell, G., Marks, G.E. New Phytol. 51: 382-387 (1952)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4136
CCDB · fl-europaea — Skalinska et al.,
CCDB · poland — Skali?ska M. et al. 1964. Additions to chromosome numbers of Polish Angiosperms (Fifth contribution). Acta Soc. Bot. Pol. 33, 45-76.
CCDB · ipcn-api-dl — KAPOOR, B. M. 1982. In IOPB chromosome number reports LXXIV. Taxon 31: 119–120.
CCDB · ipcn-api-dl — Gopinathan, M. C. & C. R. Babu. 1981. Natural hybridization in the genus Galinsoga Ruiz and Pavon (Asteraceae). J. Cytol. Genet. 16: 111–123.
CCDB · ipcn-api-dl — D'Ovidio, R. 1984. Numeri cromosomici per la flora Italiana: 1011--1021. Inform. Bot. Ital. 16: 251–260.
CCDB · ipcn-api-dl — Khonglam, A., R. P. Roy & B. Dutt. 1984. B-chromosomes and cytology of Galinsoga parviflora and G. ciliata. Nucleus 27: 164–168.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1990. Chromosome numbers in some representatives of the families Asclepiadaceae, Asteraceae, Boraginaceae, Chenopodiaceae, Lamiaceae, Oleaceae, Onagraceae, Scrophulariaceae, Solanaceae, Urticaceae from the Soviet Far East. Bot. Žhurn. (Moscow & Leningrad) 75: 1619–1622.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1986. Chisla khromosom nekotorych vidov rastenij Berezinskogo Biosfernogo Zapovednika. Zapov. Belorussii Issl. 10: 24–28.
CCDB · ipcn-api-dl — Morton, J. K. 1993. Chromosome numbers and polyploidy in the flora of Cameroon Mountain. Opera Bot. 121: 159–172.
CCDB · ipcn-api-dl — Murin, A. 1974. In Index of chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.
CCDB · ipcn-api-dl — Canne, J. M. 1983. Cytological and morphological observations in Galinsoga and related genera (Asteraceae). Rhodora 85: 355–366.
CCDB · ipcn-api-dl — Kapoor, B. M., S. Ramcharitar & C. Gervais. 1987. Liste annotée de nombres chromosomiques de la flore vasculaire du nord-est de l'Amérique. Naturaliste Canad. 114: 105–116.
CCDB · ipcn-api-dl — Probatova, N. S., A. P. Sokolovskaja & E. G. Rudyka. 1991. Chromosome numbers in some species of vascular plants from the Soviet Far East and other regions of the USSR. Bot. Žhurn. (Moscow & Leningrad) 76: 1174–1178.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-ipcn73-74 — VAN LOON, J. 1974. A cytological investigation of flowering plants from the Canary islands. Acta Bot. Neerl. 23: 113-124.
CCDB · book-indian_vol1 — Haskell, G. & Marks, G.B. 1952 ; Solbrig, O.T. et al. 1972; Gopinathan, M.C. & Babu, C.R. 1982
CCDB · book-atlas-flowering-plants
CCDB · iapt — IAPT/IOPB Chromosome Data 20
CCDB · iapt — IAPT/IOPB Chromosome Data 34
GIFT · GIFT (floras)
2n 164×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-indian_vol1 +1
CCDB · ipcn-api-dl — Hill, L. M. 1989. IOPB chromosome data 1. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 13: 17–19.
CCDB · book-ipcn72 — GADELLA, T.W.J. 1972. Cytological studies on some flowering plants collected in Africa. Bull. Jard. Bot. Nat. Belg. 42: 393-402.
CCDB · book-indian_vol1 — Gadella, T.W.J. 1972
GIFT · GIFT (floras)
2n 362×CCDB · fl-europaea · CCDB · book-atlas-flowering-plants
CCDB · fl-europaea — Reese, 1952
CCDB · book-atlas-flowering-plants — Reese 1952a " " "
2n 481×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 641×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 169×CCDB · ipcn-api-dl · CCDB · book-ipcn72
CCDB · ipcn-api-dl — Gill, L. S. & I. D. Omoigui. 1988. Cytomorphology of the tribe Heliantheae (Asteraceae) from southern Nigeria. Feddes Repert. 99: 1–13.
CCDB · ipcn-api-dl — Gill, L. S. & I. D. Omoigui. 1987. The incidence of polyploidy in family Asteraceae in southern Nigeria. Rev. Cytol. Biol. Vég., Bot. 10: 177–184.
CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.
CCDB · ipcn-api-dl — Dillon, M. O. 1982. Family Compositae: Part IV. Tribe Cardueae. Flora of Peru. Fieldiana, Bot., n.s. 10: 1–8.
CCDB · ipcn-api-dl — Robinson, H., A. M. Powell, R. M. King & J. F. Weedin. 1981. Chromosome Numbers in Compositae, XII: Heliantheae. Smithsonian Contr. Bot. 52: 1–28.
CCDB · ipcn-api-dl — Kapoor, B. M., S. Ramcharitar & C. Gervais. 1987. Liste annotée de nombres chromosomiques de la flore vasculaire du nord-est de l'Amérique. Naturaliste Canad. 114: 105–116.
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — Strother, J. L. & J. L. Panero. 2001. Chromosome studies: Mexican Compositae. Amer. J. Bot. 88(3): 499–502.
CCDB · book-ipcn72 — SOLBRIG, O.T., D.W. KYHOS, M. POWELL, & P.H. RAVEN. 1972. Chromosome numbers in Compositae VIII: Heliantheae. Amer. J. Bot. 59: 869-878.
n 242×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Rozenblum, E., C. E. Waisman & J. H. Hunziker. 1985. Estudios cariológicos en Compositae. II. Darwiniana 26: 15–25.
CCDB · ipcn-api-dl — Hunziker, J. H., A. Escobar, C. C. Xifred & J. C. Gamerro. 1990. Estudios cariologicos en Compositae. VI. Darwiniana 30: 115–121.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type132 195 records
Wild obs. + sensor124 966
Museum / vouchered6 937
Cultivated / captive6
Other286
Origin
Native52
Introduced3 268
Range
Area of Occupancy AOO196 544 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy51% within 1 km
≤100 m 35 268≤1 km 19 683≤10 km 52 208>10 km 670
107 829 georeferenced · 17 137 without coordinates
Open the mapobservation + sensor124 966
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy57% within 1 km
≤100 m 815≤1 km 1 311≤10 km 1 429>10 km 155
3 710 georeferenced · 3 227 without coordinates
Open the institutions mapphysical evidence6 937
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy33% within 1 km
≤1 km 1≤10 km 2
3 georeferenced · 3 without coordinates
Open the mapnot free-living6
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions197 of 366 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 521 |
| Saint Louis, US | 316 |
| Olocation not on record | 250 |
| Chongqing Museumlocation not on record | 215 |
| Odawara, JP | 174 |
| Durango, MX | 167 |
| LDlocation not on record | 166 |
| University of Stellenboschlocation not on record | 127 |
| Moscow State Universitylocation not on record | 120 |
| Austin, US | 116 |
| Madison, US | 110 |
| SLU Artdatabankenlocation not on record | 104 |
| National Biodiversity Institute, Costa Ricalocation not on record | 102 |
| BIO-UNIPIlocation not on record | 100 |
| Bronx, US | 96 |
| Nagano City, JP | 92 |
| Brussel, BE | 87 |
| KMNlocation not on record | 77 |
| Oskarshamn, SE | 71 |
| Kochi, JP | 70 |
| Bloomington, US | 61 |
| Kew, GB | 55 |
| Allentown, US | 53 |
| Tapachula, MX | 52 |
| Mexico City, MX | 47 |
| Tsukuba, JP | 44 |
| BRNUlocation not on record | 43 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 40 |
| Shinshu Universitylocation not on record | 37 |
| Tomioka, JP | 36 |
| Oulu, FI | 36 |
| Toyama, JP | 35 |
| MeiseBGlocation not on record | 35 |
| Burlington, US | 32 |
| Adam Mickiewicz University in Poznańlocation not on record | 31 |
| DBF-NHMDlocation not on record | 29 |
| Williamsburg, US | 27 |
| Chapel Hill, US | 27 |
| Fukushima Universitylocation not on record | 27 |
| National Institute of Biological Resourceslocation not on record | 27 |
| University of New Hampshirelocation not on record | 26 |
| South Kensington, GB | 26 |
| Tokushima, JP | 26 |
| Xiamen, CN | 25 |
| Berlin, DE | 25 |
| Wuzhou, CN | 22 |
| Montréal, CA | 22 |
| College Park, US | 22 |
| Puerto Ayora, EC | 21 |
| Universidad de Caldas (UCaldas)location not on record | 21 |
| Turku, FI | 21 |
| St. Paul, US | 21 |
| Auckland, NZ | 21 |
| Antiguo Cuscatlán, SV | 20 |
| Hiratsuka City Museumlocation not on record | 20 |
| Stockholm, SE | 20 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 20 |
| Universidad Nacional de Colombia (UNAL)location not on record | 20 |
| Trondheim, NO | 20 |
| San Diego, US | 19 |
| BDBClocation not on record | 19 |
| Dekalb, US | 18 |
| Ann Arbor, US | 18 |
| TAIElocation not on record | 18 |
| Mexico City, MX | 18 |
| MAlocation not on record | 17 |
| Kathmandu, NP | 16 |
| León, NI | 16 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 15 |
| Tampa, US | 15 |
| Toronto, CA | 14 |
| Morgantown, US | 14 |
| Bergen, NO | 14 |
| Awka, NG | 14 |
| Mlocation not on record | 14 |
| DMZ botanic gardenlocation not on record | 14 |
| Christchurch, NZ | 14 |
| Taipei, TW | 13 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 13 |
| San José, CR | 13 |
| Millersville, US | 13 |
| Parthenon Tama History Museumlocation not on record | 13 |
| Wlocation not on record | 13 |
| Emporia, US | 13 |
| Austin, US | 13 |
| Miami, US | 12 |
| Knoxville, US | 12 |
| Sagamihara, JP | 12 |
| Aarhus, DK | 12 |
| Guatemala City, GT | 12 |
| Sendai, JP | 11 |
| Bando, JP | 11 |
| Córdoba, AR | 11 |
| Iwate Prefectural Museumlocation not on record | 11 |
| BFLlocation not on record | 11 |
| Saint John, CA | 11 |
| Guasave, MX | 11 |
| Jardín Botánico de Bogotá José Celestino Mutis (JBB)location not on record | 11 |
| Universidad de Antioquia (UdeA)location not on record | 10 |
| Green Bay, US | 10 |
| Osaka, JP | 10 |
| Universiti Sains Malaysialocation not on record | 10 |
| Pretoria, ZA | 10 |
| Tartu, EE | 10 |
| Uppsala, SE | 9 |
| EL PASO, US | 9 |
| Taipei, TW | 9 |
| Riverside, US | 9 |
| NSMKlocation not on record | 9 |
| Tilburg, NL | 9 |
| Cambridge, US | 8 |
| Portland, US | 8 |
| JP | 8 |
| Norfolk, US | 8 |
| Korea National Arboretumlocation not on record | 8 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 8 |
| Chicago, US | 8 |
| Frankfurt am Main | 8 |
| Laboratory of Palaeontologylocation not on record | 8 |
| WINlocation not on record | 8 |
| Keene State Universitylocation not on record | 8 |
| TUR-Alocation not on record | 8 |
| Hudson, US | 8 |
| Loja, EC | 8 |
| Frauenfeld, CH | 8 |
| Akita Prefectural Museumlocation not on record | 7 |
| Otaru, JP | 7 |
| Zacatecas, MX | 7 |
| Tuxtla Gutiérrez, MX | 7 |
| Hobart, AU | 7 |
| Québec, CA | 7 |
| Toluca, MX | 7 |
| Bern, CH | 6 |
| Beijing, CN | 6 |
| Harrisonburg, US | 6 |
| SIHUlocation not on record | 6 |
| Whitewater, US | 6 |
| Durban, ZA | 6 |
| Natural History Museum Rotterdamlocation not on record | 6 |
| Porvoo, FI | 5 |
| Rotorua, NZ | 5 |
| Istituto Agrario Castelnuovolocation not on record | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| McWane Science Centerlocation not on record | 5 |
| QCNElocation not on record | 5 |
| Toyota city nature sanctuarylocation not on record | 5 |
| J.F.Oberlin Universitylocation not on record | 5 |
| Kagoshima, JP | 5 |
| Western Carolina Universitylocation not on record | 5 |
| HUT Culture Collectionlocation not on record | 5 |
| INMAlocation not on record | 5 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 5 |
| Glarus, CH | 5 |
| Wellington, NZ | 5 |
| MEXUlocation not on record | 4 |
| San Isidro, AR | 4 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 4 |
| Corvallis, US | 4 |
| Santa Cruz de la Sierra, BO | 4 |
| CUVClocation not on record | 4 |
| Canadian Department of Agriculturelocation not on record | 4 |
| Vancouver, CA | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| GJOlocation not on record | 4 |
| Paris, FR | 4 |
| Autlán de Navarro, MX | 4 |
| Chadron, US | 4 |
| Sucre, BO | 4 |
| Nishihara, JP | 4 |
| Davis, US | 4 |
| DNSMlocation not on record | 4 |
| Philadelphia, US | 4 |
| Bangkok, TH | 4 |
| Ciudad de México, MX | 4 |
| Columbia, US | 4 |
| Clemson, US | 4 |
| KIRMlocation not on record | 4 |
| UTPLlocation not on record | 4 |
| Uniwersytet Opolskilocation not on record | 4 |
| BSBIlocation not on record | 4 |
| H-Resselocation not on record | 3 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 3 |
| Universidad de La Salle (La Salle)location not on record | 3 |
| València, ES | 3 |
| Dover, US | 3 |
| UNESClocation not on record | 3 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 3 |
| Provincia di Livornolocation not on record | 3 |
| Denver, US | 3 |
| Kuopio, FI | 3 |
| WTUlocation not on record | 3 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 3 |
| Provo, US | 3 |
| CJBNlocation not on record | 3 |
| NMBU:MINAlocation not on record | 3 |
| Flagstaff, US | 3 |
| Tuscaloosa, US | 3 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| Mississippi State, US | 3 |
| Chicago, US | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Guatemala, GT | 3 |
| Pullman, US | 3 |
| Culiacán, MX | 3 |
| PrivatHerblocation not on record | 3 |
| Jackson, US | 3 |
| Kushiro City Museumlocation not on record | 3 |
| Calabar, NG | 3 |
| JBRJlocation not on record | 3 |
| Santa Teresa, BR | 3 |
| Asheville, US | 3 |
| The Cattle Museumlocation not on record | 2 |
| Forssa, FI | 2 |
| OTSlocation not on record | 2 |
| University of Alberta Museumslocation not on record | 2 |
| Shanghai, CN | 2 |
| München, DE | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| Criciúma, BR | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Victoria, CA | 2 |
| Mexico City, MX | 2 |
| nbflocation not on record | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| UFBAlocation not on record | 2 |
| Beijing Normal Universitylocation not on record | 2 |
| Hanshan Normal Universitylocation not on record | 2 |
| KNAMlocation not on record | 2 |
| University of Southern Mississippilocation not on record | 2 |
| Altos de Pipe, VE | 2 |
| HUAlocation not on record | 2 |
| La Paz, MX | 2 |
| Sion, CH | 2 |
| Montecillo, Texcoco, MX | 2 |
| Northridge, US | 2 |
| BMlocation not on record | 2 |
| LINUlocation not on record | 2 |
| Maringá, BR | 2 |
| Iquitos, PE | 2 |
| Cambridge, US | 2 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 2 |
| Podgorica, ME | 2 |
| San Luis Obispo, US | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Université Lavallocation not on record | 2 |
| Fairfax, US | 2 |
| Sangmiung Universitylocation not on record | 2 |
| Little Rock, US | 2 |
| UNESP-FCAlocation not on record | 2 |
| PUC-RSlocation not on record | 2 |
| Lima, PE | 2 |
| UFSClocation not on record | 2 |
| Omachi Alpine Museumlocation not on record | 2 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 2 |
| New Brunswick, US | 2 |
| University of Wisconsinlocation not on record | 2 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 2 |
| Philadelphia, US | 2 |
| Museo Entomologico de Leonlocation not on record | 2 |
| La Paz, BO | 2 |
| CJBGlocation not on record | 2 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 2 |
| Johnson City, US | 2 |
| Zürich, CH | 2 |
| Nishihara, JP | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| Richmond, US | 1 |
| Porto Alegre, BR | 1 |
| Göteborg, SE | 1 |
| Feira de Santana, BR | 1 |
| Armidale, AU | 1 |
| Missoula, US | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Minia, EG | 1 |
| UFPRlocation not on record | 1 |
| IWEP FEB RASlocation not on record | 1 |
| GB | 1 |
| Durham, US | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| Juriquilla, MX | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Herbario de la Universidad Técnica del Nortelocation not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| Bogotá, D.C., CO | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 1 |
| Macomb, US | 1 |
| UFOPlocation not on record | 1 |
| Pittsburg, US | 1 |
| Jardim Botânico do Rio de Janeirolocation not on record | 1 |
| Vitoria, ES | 1 |
| US | 1 |
| Campo Mourão, BR | 1 |
| Zürich, CH | 1 |
| Porrentruy, CH | 1 |
| Campo Grande, BR | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Arcata, US | 1 |
| UFRRJlocation not on record | 1 |
| Seropédica, BR | 1 |
| Dresden, DE | 1 |
| UNISANTAlocation not on record | 1 |
| Brisbane, AU | 1 |
| Albuquerque, US | 1 |
| KOMlocation not on record | 1 |
| Phoenix, US | 1 |
| NoColllocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| UFMSlocation not on record | 1 |
| GAlocation not on record | 1 |
| UFESlocation not on record | 1 |
| UFMGlocation not on record | 1 |
| Tulane Universitylocation not on record | 1 |
| Hermosillo, MX | 1 |
| UMKClocation not on record | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| Jurica-Suchy Nature Museumlocation not on record | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Canberra, AU | 1 |
| Provincial Museum of Albertalocation not on record | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| Cochabamba, BO | 1 |
| Ivano-Frankivsk, UA | 1 |
| IPA/SPlocation not on record | 1 |
| Pelotas, BR | 1 |
| Palmerston North, NZ | 1 |
| HUENFlocation not on record | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| UTFPR-SLlocation not on record | 1 |
| Honolulu, US | 1 |
| IEBlocation not on record | 1 |
| Lake Charles, US | 1 |
| Taipei, TW | 1 |
| Guiyang, CN | 1 |
| Central China Normal Universitylocation not on record | 1 |
| Clocation not on record | 1 |
| Corrientes, AR | 1 |
| Cenit Transporte y Logística de Hidrocarburos S.A.S. (CENIT)location not on record | 1 |
| Quito, EC | 1 |
| Masindi, UG | 1 |
| FUNEDlocation not on record | 1 |
| Jaén, ES | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Logan, US | 1 |
| Salamanca, ES | 1 |
| Acadia Universitylocation not on record | 1 |
| Zlocation not on record | 1 |
| Universidad de la Amazonialocation not on record | 1 |
| Durham, US | 1 |
| IPE-CSIClocation not on record | 1 |
| FPMZBlocation not on record | 1 |
| UFABClocation not on record | 1 |
| Herb. BBGlocation not on record | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Nijmegen, NL | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| UNESP-ISlocation not on record | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
366 institutions · 6 622 of 6 937 vouchered records shown · 292 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA22 detections
Where the DNA of Galinsoga quadriradiata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found22
Studies independent surveys1
Countries9
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 22 detections have coordinates
Open the map9 countries0
hedgerow
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.5 °C 6.70–18.7
Seasonal swing summer↔winter19.6 °C
Max temp (day)18.9 °C 8.50–22.1
Min temp (night)9.30 °C 4.80–15.7
Precipitation72.3 mm/mo 59.9–81.5
Air humidity59.9 % 57.3–67.5
Moisture balance-28.0 mm/mo -56.0–31.2
Vapour deficit733 Pa 345–816
Wind speed3.20 m/s 2.50–5.80
Cloud cover40.9 % 36.1–57.1
CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.