Galinsoga parviflora
Cav. · speciesAt a glance
Occurrence records68 553
Data sources14
Biological traits76
DNA specimens48
eDNA detections84
Sources14 archives
Databases and archives Galinsoga parviflora's data was compiled from.
WikipediaWikimedia Foundation12 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility68 553 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI84 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics48 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources76 traits
Chemical compositionLOTUS17 compounds
Occurrence & distributionGBIF68 553 records
Environmental DNA2 datasets · 11 countries84 detections
DNA & barcodingBOLD · NCBI48 specimens
Genome at a glanceCCDB · GIFT · GoaT724 Mbp
01Narrative
Galinsoga parvifloraRoyal New Zealand Institute of Horticulture – Horticulture Pages – Weeds – Index of names is a herbaceous plant in the Asteraceae (daisy) family. It has several common names including guasca (Colombia), pacpa yuyo, paco yuyo and waskha (Peru), burrionera (Ecuador), albahaca silvestre and saetilla (Argentina), mielcilla (Costa Rica), piojito (Oaxaca, Mexico), galinsoga (New Zealand), gallant soldier, quickweed, and potato weed (United Kingdom, United States).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology26
Fruit length1.75 mm
⚠ sources differ — AusTraits: 1.75 mm · GIFT: 1.62 mm
Fruit length max1.8 mm
Fruit length min1 mm
Fruit width2 mm
Leaf length40 mm
Leaf length max60 mm
Leaf length min10 mm
Leaf mass13.38 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 535 mm² · GIFT: 535 mm²
Leaf width22.5 mm
Leaf width max40 mm
Leaf width min5 mm
Petiole length2 cm
Plant height0.509 m
⚠ sources differ — GIFT: 0.509 m · AusTraits: 0.5 m · LEDA: 0.325 m · TRY: 0.406 m
Plant height generative0.361 m
Plant height max1 m
Plant height min0.07 m
Seed length1.5 mm
⚠ sources differ — TRY: 1.5 mm · GIFT: 1 mm
Seed length max1 mm
Seed length min1 mm
Seed mass0.232 mg
⚠ sources differ — TRY: 0.232 mg · LEDA: 0.194 mg · GIFT: 0.213 mg
Seed mass max0.25 mg
Seed mass min0.18 mg
Seed volume0.17 mm³
Seed volume max0.17 mm³
Seed volume min0.17 mm³
Life cycle & reproduction21
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: anemochorous
Flower colourwhite
Flower width max7 mm
Flower width min4 mm
Flowering endOct
Flowering startMay
Flowering timeynnnnnnnyyyy
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Reproductive maturity0.288 years
Resprouting capacityfire_killed
Seed number36 851
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment17
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max3 100 m
Elevation mean1 950 m
Elevation min0 m
Epiphyteterrestrial
Fruit colourblack
Fruit fleshinessdry
Fruit typeachene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: annual herb
Habitat GIFTÁrea Antrópica
Leaf compoundnesssimple
Leaf formovate
Leaf shapelanceolate ovate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry6
Leaf dry-matter content (LDMC)189 mg/g
⚠ sources differ — TRY: 189 mg/g · LEDA: 248 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)48.4 mm²/mg
⚠ sources differ — TRY: 48.4 mm²/mg · LEDA: 39.24 mm²/mg · GIFT: 39.17 mm²/mg
Wood density91.94 mg/cm³
Other traits4
Diaspore typefruit with appendage
Leaf arrangementopposite
Seeds per fruit101-1000
Shoot orientationerect
03Chemical composition17 compounds
Compounds documented for Galinsoga parviflora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavones4
Flavanones2
Stigmastane steroids2
Linear diarylheptanoids2
Shikimic acids and derivatives $ Simple phenolic acids1
Documented compounds17 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2R,3S,4S,5S)-2,3,4,5-Tetrakis[(E)-3-(3,4-dihydroxyphenyl)prop-2-enoyl]-2,3,4,5-tetrahydroxyhexanedioic acid | present | LOTUS | |
| (2S)-2-(3,4-dihydroxyphenyl)-7-methoxy-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3-dihydrochromen-4-one | present | LOTUS | |
| (2S)-2-[5-hydroxy-2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]-7-methoxy-2,3-dihydrochromen-4-one | present | LOTUS | |
| (3S,8S,9S,10R,13R,14S,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthrene-3,7-diol | present | LOTUS | |
| (3S,8S,9S,10R,13R,14S,17R)-17-[(E,2R,5S)-5-ethyl-6-methylhept-3-en-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthrene-3,7-diol | present | LOTUS | |
| 1,4-Bis(decyl) benzene-1,4-dicarboxylate | present | LOTUS | |
| 2-(3,4-dihydroxyphenyl)-5-hydroxy-7-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one | present | LOTUS | |
| 5-hydroxy-2-(4-hydroxyphenyl)-4-oxo-4H-1-benzopyran-7-yl beta-L-glucopyranoside | present | LOTUS | |
| [(1S,4S,5R,6S,8R,9R,13S,16S,18S)-11-ethyl-8,9-dihydroxy-4,6,16,18-tetramethoxy-11-azahexacyclo[7.7.2.12,5.01,10.03,8.013,17]nonadecan-13-yl]methyl 2-aminobenzoate | present | LOTUS | |
| Apiumetrin | present | LOTUS |
05DNA & barcoding48 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galinsoga parviflora has left across the world's sequence archives.
At a glance
DNA specimens48
Marker genes8
GenBank sequences10
eDNA detections84
Countries11
The DNA barcodea real sequence read deposited for this species
GAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGTTGAGGGCACGTCTGCCTGGGCGTCACG …
Galinsoga parviflora voucher KAUITS25 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK5★rbcL3★rbcLa★trnL-F★ITS2★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Galinsoga parviflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size723 720 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Galinsoga parviflora0.72 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× / 4× cytotypes
Chromosome records16–362n range16median16mode51records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1640×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +15
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — PAVONE P., TERRASI M.C., ZIZZA A. - 1981. Numeros cromosomaticos de plantas occidentales 113-128.. Anales Jard. Bot. Madrid , 38(1): 273-280.
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · brit-fl — Haskell, G., Marks, G.E. New Phytol. 51: 382-387 (1952)
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4135
CCDB · fl-europaea — Fernandes & Queiros,
CCDB · poland — Skali?ska M. et al. 1964. Additions to chromosome numbers of Polish Angiosperms (Fifth contribution). Acta Soc. Bot. Pol. 33, 45-76.
CCDB · ipcn-api-dl — Canne, J. M. 1983. Cytological and morphological observations in Galinsoga and related genera (Asteraceae). Rhodora 85: 355–366.
CCDB · ipcn-api-dl — Pavone, P., M. C. Terrasi & A. Zizza. 1981. Números cromosomáticos de plantas occidentales, 113-128. Anales Jard. Bot. Madrid 38: 273–280.
CCDB · ipcn-api-dl — Gopinathan, M. C. & C. R. Babu. 1981. Natural hybridization in the genus Galinsoga Ruiz and Pavon (Asteraceae). J. Cytol. Genet. 16: 111–123.
CCDB · ipcn-api-dl — Nirmala, A. & P. N. Rao. 1986. Karyotype studies in some Asteraceae. Kromosomo 42: 1311–1315.
CCDB · ipcn-api-dl — Khonglam, A., R. P. Roy & B. Dutt. 1984. B-chromosomes and cytology of Galinsoga parviflora and G. ciliata. Nucleus 27: 164–168.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1990. Chromosome numbers in some representatives of the families Asclepiadaceae, Asteraceae, Boraginaceae, Chenopodiaceae, Lamiaceae, Oleaceae, Onagraceae, Scrophulariaceae, Solanaceae, Urticaceae from the Soviet Far East. Bot. Žhurn. (Moscow & Leningrad) 75: 1619–1622.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1986. Chisla khromosom nekotorych vidov rastenij Berezinskogo Biosfernogo Zapovednika. Zapov. Belorussii Issl. 10: 24–28.
CCDB · ipcn-api-dl — Nirmala, A. & P. N. Rao. 1984. Karyotype studies in Asteraceae. Cell Chromosome Res. 7: 26–28.
CCDB · ipcn-api-dl — Probatova, N. S., E. G. Rudyka & A. P. Sokolovskaya. 1996. Chromosome numbers in synanthropic plants from the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 81(5): 98–101.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Peng, C. i. & C. c. Hsu. 1977. In IOPB chromosome number reports LVIII. Taxon 26: 557–565.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn67-71 — CHATTERJEE, T., & A.K. SHARMA. 1968. Cytological studies on different genera of three tribes of Compositae. Bull. Bot. Soc. Bengal 22: 101-104.
CCDB · book-ipcn67-71 — TORRES, A.M., & A.H. LIOGIER. 1970. Chromosome numbers of Dominican Compositae. Brittonia 22: 240-245.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1967. Chromosome numbers of flowering plants in the Netherlands III. Proc. Roy. Neth. Acad. Sci. Ser. c. 70: 7-20.
CCDB · book-indian_vol1 — Covas, G. & Schnack, B. 1946 ; Polya, L. 1950 ; Haskell, G. & Marks, G.B. 1952 ; Haskell, G. 1954; Mehra, P.N. & Sidhu, S.S. 1960 ; Diers, L. 1961 ; Koul, M.L.H. 1964a ; Skalifiska, M. et a./. 1964 ; Mehra, P.N. et al. 1965 ; Tur- ner, B.L. & Lewis, W.H.1965; Gadel- la, T.W.J. & Kliphuis, E. 1967; Chatterjee, T. & Sharma, A.K. 1968 ; Narayan, K.N. & Sbukur, A. 1968 ; Subramanyam, K. & Kamble, N.P. 1967 ; Majovsky, J. et al. 1970b ; Powell, A.M. & Sikes, S. 1970 ; Torres, A.M. & Liogier, A.H.1970; Fernan- des, A & Queiros, M. 1971 ; Solbrig, 0. T. et al. 1972 ; Mehra, P. N. & Rema- nandan, P. 1974; Strother, J.L. 1976; Peng, C.-I. & Hsu, C.-C. 1977 ; Gopinathan, M.C. & Babu, C.R. 1982
CCDB · book-indian_vol1 — Gopinathan, M.C. & Babu, C.R, 1982
CCDB · eflora
CCDB · book-atlas-flowering-plants — Covas & S. 1946
CCDB · book-atlas-flowering-plants — Haskell & M. 1952
CCDB · kew — Bennett MD, Leitch IJ, Hanson L. 1998. DNA amounts in two samples of angiosperm weeds. Annals of Botany 82 (Supplement A): 121-134.
CCDB · Cave1962 — Turner et al. 1962
CCDB · CromoCat 2015 — Magulaev, A. Y. (1982). The number of chromosomes of the species of Asteraceae, Caryophyllaceae and Plantaginaceae of the North Caucasus Biologicheskie Nauki 11 (227): 74-79
CCDB · CromoCat 2015 — Dobeš, C., Hahn, B. & Morawetz, W. (1997). Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5-43.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1971a). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae. Bol. Soc. Brot. 45: 5-122.
CCDB · CromoCat 2015 — Probatova, N. S., Seledets, V. P., Gnutikov, A. A. & Shatokhina, A. V. (2008). IAPT/IOPB Chromosome Data 6 Taxon 57(4): 1267-1273
CCDB · iapt — IAPT/IOPB Chromosome Data 26
GIFT · GIFT (floras)
2n 326×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · eflora +2
CCDB · ipcn-api-dl — Jose, J. C. & P. M. Mathew. 1995. Chromosome numbers in the south Indian Heliantheae (Compositae). Compositae Newslett. 27: 7–10.
CCDB · book-indian_vol1 — Turner, B.L. & King, R.M. 1964 ; Turner, B.L. & Flyr, D. 1966; Longpre, E.K. 1970; Weedin, J.P. & Powell, A.M.1978
CCDB · eflora
CCDB · CromoCat 2015 — Magulaev, A. Y. (1982). The number of chromosomes of the species of Asteraceae, Caryophyllaceae and Plantaginaceae of the North Caucasus Biologicheskie Nauki 11 (227): 74-79
CCDB · CromoCat 2015 — Jose, J. C. & Mathew, P. M. (1995). Chromosome numbers in the south Indian Heliantheae (Compositae). Compositae Newsletter 27: 7-10.
GIFT · GIFT (floras)
2n 03×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bala, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1784-1786
CCDB · CromoCat 2015 — Strother, J. L. & J. L. Panero. (2001). Chromosome studies: Mexican Compositae. Amer. J. Bot. 88(3): 499–502.
2n 243×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Gopinathan, M. C. & C. R. Babu. 1981. Natural hybridization in the genus Galinsoga Ruiz and Pavon (Asteraceae). J. Cytol. Genet. 16: 111–123.
CCDB · book-indian_vol1 — Gopinathan, M.C. & Babu, C.R. 1982
CCDB · CromoCat 2015 — Gopinathan, M. C. & Babu, C. R. (1981). Natural hybridization in the genus Galinsoga Ruiz and Pavon (Asteraceae). Journal of Cytology and Genetics 16: 111-123
2n 362×CCDB · book-indian_vol1 · GIFT · GIFT (floras)
CCDB · book-indian_vol1 — Tischler, G. 1934 ; Rohweder, H. 1937; Delay, C. 1947
GIFT · GIFT (floras)
n 824×CCDB · iapt · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +5
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · book-ipcn65 — Mehra et al. 1965; Turner & L. 1965
CCDB · ipcn-api-dl — Canne, J. M. 1983. Cytological and morphological observations in Galinsoga and related genera (Asteraceae). Rhodora 85: 355–366.
CCDB · ipcn-api-dl — Banerjee, A. K. 1971. Cytological investigations on some Indian members of the tribe Helianthoideae (Family -- Compositae). J. Cytol. Genet. 6: 90–109.
CCDB · ipcn-api-dl — Gupta, R. C. & R. K. Garg. 1987. SOCGI plant chromosome number reports -- IV [i.e., V]. J. Cytol. Genet. 22: 162–163.
CCDB · ipcn-api-dl — Gill, L. S. & I. D. Omoigui. 1988. Cytomorphology of the tribe Heliantheae (Asteraceae) from southern Nigeria. Feddes Repert. 99: 1–13.
CCDB · ipcn-api-dl — Husaini, S. W. H. & G. A. Iwo. 1990. Cytology of some weedy species of the family Compositae (Asteraceae) from Jos Plateau, Nigeria. Feddes Repert. 101: 49–62.
CCDB · ipcn-api-dl — Gill, L. S. & I. D. Omoigui. 1987. The incidence of polyploidy in family Asteraceae in southern Nigeria. Rev. Cytol. Biol. Vég., Bot. 10: 177–184.
CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1988. SOCGI plant chromosome number reports -- VI. J. Cytol. Genet. 23: 38–52.
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1989. Cytopalynology of north and central Indian Compositae. J. Cytol. Genet. 24: 96–105.
CCDB · ipcn-api-dl — Gupta, R. C., B. S. Gill & R. K. Garg. 1989. Chromosomal conspectus of western Himalayan Compositae. Aspects Pl. Sci. 11: 427–437.
CCDB · ipcn-api-dl — Razaq, Z. A., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800–808.
CCDB · ipcn-api-dl — Nirmala, A. & P. N. Rao. 1981. In Chromosome number reports LXX. Taxon 30: 78.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · ipcn-api-dl — Strother, J. L. 1976a. Chromosome studies in Compositae. Amer. J. Bot. 63: 247–250.
CCDB · book-ipcn66 — Turner & Flyr 1966
CCDB · book-ipcn72 — SOLBRIG, O.T., D.W. KYHOS, M. POWELL, & P.H. RAVEN. 1972. Chromosome numbers in Compositae VIII: Heliantheae. Amer. J. Bot. 59: 869-878.
CCDB · book-ipcn67-71 — CHATTERJEE, T., & A.K. SHARMA. 1968. Cytological studies on different genera of three tribes of Compositae. Bull. Bot. Soc. Bengal 22: 101-104.
CCDB · book-ipcn67-71 — POWELL, A.M. & s. SIKES. 1970. Chromosome numbers of some chihuahuan desert Compositae. Southw. Naturalist 15: 175-186.
CCDB · book-ipcn73-74 — MEHRA, P.N., & R. REMANANDAN. 1974. Cytolog>cal >nvestigat>ons on th[ Indian Compositae. II. Astereae, Hel~antheae, Helenleae, and Anthemideae. Caryologia 27: 255-289.
CCDB · CromoCat 2015 — Nirmala, A. & P. N. Rao. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXX]. Taxon 30(1): 78.
CCDB · CromoCat 2015 — Subramanyam, K. & N. P. Kamble. (1967). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XII]. Taxon 16(4): 341-350.
CCDB · CromoCat 2015 — Bala, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1784-1786
n 169×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71 +1
CCDB · ipcn-api-dl — Canne, J. M. 1983. Cytological and morphological observations in Galinsoga and related genera (Asteraceae). Rhodora 85: 355–366.
CCDB · ipcn-api-dl — Ward, D. E. 1983. Chromosome counts from New Mexico and southern Colorado. Phytologia 54: 302–309.
CCDB · ipcn-api-dl — Jose, J. C. & P. M. Mathew. 1995. Chromosome numbers in the south Indian Heliantheae (Compositae). Compositae Newslett. 27: 7–10.
CCDB · ipcn-api-dl — Weedin, J. F. & A. M. Powell. 1978. In IOPB chromosome number reports LX. Taxon 27: 223–231.
CCDB · ipcn-api-dl — Ward, D. E. & R. W. Spellenberg. 1986. Chromosome counts of angiosperms of western North America. Phytologia 61: 119–125.
CCDB · book-ipcn66 — Turner & Flyr 1966
CCDB · book-ipcn67-71 — LONGPRE, E.K. 1970. The systematica of the genera Sabazia, Selloa and Tricarpha (Compositael. Publ. Mus. Mich. state Univ. Biol. Ser. 4(8): 283-384.
CCDB · CromoCat 2015 — Weedin, J. F. & A. M. Powell. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LX]. Taxon 27(2/3): 230-231.
CCDB · CromoCat 2015 — Bala, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1784-1786
n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Magulaev, A. Y. (1982). The number of chromosomes of the species of Asteraceae, Caryophyllaceae and Plantaginaceae of the North Caucasus Biologicheskie Nauki 11 (227): 74-79
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type68 553 records
Wild obs. + sensor56 967
Museum / vouchered10 685
Cultivated / captive6
Other895
Origin
Native80
Introduced2 112
Range
Area of Occupancy AOO133 024 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy45% within 1 km
≤100 m 11 754≤1 km 9 074≤10 km 24 780>10 km 520
46 128 georeferenced · 10 839 without coordinates
Open the mapobservation + sensor56 967
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy44% within 1 km
≤100 m 1 038≤1 km 1 802≤10 km 3 493>10 km 148
6 481 georeferenced · 4 204 without coordinates
Open the institutions mapphysical evidence10 685
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy50% within 1 km
≤1 km 2≤10 km 1>10 km 1
4 georeferenced · 2 without coordinates
Open the mapnot free-living6
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions240 of 459 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 4 062 |
| Mexico City, MX | 258 |
| LDlocation not on record | 222 |
| Uniwersytet Warszawskilocation not on record | 195 |
| Durango, MX | 178 |
| Saint Louis, US | 135 |
| Beijing, CN | 133 |
| Chengdu, CN | 123 |
| Bronx, US | 113 |
| BFLlocation not on record | 109 |
| Austin, US | 105 |
| SLU Artdatabankenlocation not on record | 104 |
| Brussel, BE | 100 |
| Chengdu, CN | 91 |
| Pretoria, ZA | 88 |
| Brisbane, AU | 88 |
| BIO-UNIPIlocation not on record | 86 |
| Moscow State Universitylocation not on record | 82 |
| Oskarshamn, SE | 82 |
| Mount Annan, AU | 72 |
| Salzburg, AT | 72 |
| Guasave, MX | 71 |
| Kew, GB | 69 |
| Olocation not on record | 69 |
| Zacatecas, MX | 68 |
| Berlin, DE | 67 |
| Mexico City, MX | 64 |
| DBF-NHMDlocation not on record | 64 |
| Adam Mickiewicz University in Poznańlocation not on record | 64 |
| UnBlocation not on record | 62 |
| Seoul, KR | 56 |
| Kunming, CN | 54 |
| Museo Entomologico de Leonlocation not on record | 50 |
| MeiseBGlocation not on record | 50 |
| University of Stellenboschlocation not on record | 50 |
| San Isidro, AR | 48 |
| Córdoba, AR | 46 |
| Riverside, US | 45 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 40 |
| BDBClocation not on record | 39 |
| BRNUlocation not on record | 39 |
| Christchurch, NZ | 37 |
| Görlitz, DE | 36 |
| Tartu, EE | 35 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 32 |
| Ciudad de México, MX | 30 |
| Taipei, TW | 29 |
| Canberra, AU | 29 |
| CASlocation not on record | 27 |
| Barcelona, ES | 26 |
| Auckland, NZ | 26 |
| Adelaide, AU | 24 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 24 |
| Bern, CH | 24 |
| ASUlocation not on record | 23 |
| New Haven, US | 23 |
| GMBAlocation not on record | 22 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 22 |
| College Park, US | 21 |
| Nanchong, CN | 21 |
| Albuquerque, US | 21 |
| KMNlocation not on record | 21 |
| CJBGlocation not on record | 20 |
| Blumenau, BR | 20 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 20 |
| MAlocation not on record | 19 |
| Oulu, FI | 19 |
| TAIElocation not on record | 19 |
| South Kensington, GB | 19 |
| Stockholm, SE | 19 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 18 |
| Istituto Agrario Castelnuovolocation not on record | 18 |
| Philadelphia, US | 18 |
| Cape Town, ZA | 17 |
| Taipei, TW | 17 |
| Uppsala, SE | 17 |
| Hobart, AU | 17 |
| Chongqing Museumlocation not on record | 17 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 17 |
| Tallinn, EE | 16 |
| Armidale, AU | 16 |
| Entomological Society of Latvialocation not on record | 16 |
| Provincia di Livornolocation not on record | 15 |
| GJOlocation not on record | 15 |
| Salamanca, ES | 15 |
| UNESClocation not on record | 15 |
| Durban, ZA | 15 |
| Nagano City, JP | 15 |
| Guangzhou, CN | 15 |
| Xiamen, CN | 14 |
| Kensington, AU | 13 |
| Phoenix, US | 13 |
| Santa Barbara, US | 13 |
| Wellington, NZ | 13 |
| Paris, FR | 13 |
| Claremont, US | 13 |
| Tapachula, MX | 12 |
| Natural History Museum Rotterdamlocation not on record | 12 |
| Juriquilla, MX | 12 |
| Vancouver, CA | 12 |
| Central China Normal Universitylocation not on record | 12 |
| Wlocation not on record | 12 |
| UTFPR-CPlocation not on record | 12 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 12 |
| Nanjing, CN | 12 |
| Corrientes, AR | 12 |
| IEBlocation not on record | 12 |
| Denver, US | 11 |
| Universidad de Caldas (UCaldas)location not on record | 11 |
| UFMGlocation not on record | 11 |
| Turku, FI | 11 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 11 |
| UFBAlocation not on record | 11 |
| Salvador, BR | 11 |
| Criciúma, BR | 10 |
| Bangkok, TH | 10 |
| EL PASO, US | 10 |
| Aarhus, DK | 10 |
| Wuhan, CN | 10 |
| Wuzhou, CN | 10 |
| Shinshu Universitylocation not on record | 10 |
| Zhejiang Universitylocation not on record | 10 |
| ISAlocation not on record | 9 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 9 |
| Williamsburg, US | 9 |
| Toluca, MX | 9 |
| Nanjing, CN | 9 |
| Frankfurt am Main | 9 |
| Campo Mourão, BR | 9 |
| University of New Hampshirelocation not on record | 9 |
| Québec, CA | 9 |
| Allentown, US | 9 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| PUC-RSlocation not on record | 8 |
| NSMKlocation not on record | 8 |
| Yunnan Universitylocation not on record | 8 |
| Wuhan, CN | 8 |
| Guiyang, CN | 8 |
| Winterthur, CH | 8 |
| Chadron, US | 8 |
| National Institute of Biological Resourceslocation not on record | 8 |
| Awka, NG | 8 |
| Taipei, TW | 8 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 8 |
| JBRJlocation not on record | 7 |
| València, ES | 7 |
| Burlington, US | 7 |
| Edinburgh, GB | 7 |
| Laboratory of Palaeontologylocation not on record | 7 |
| Pelotas, BR | 7 |
| Canadian Department of Agriculturelocation not on record | 7 |
| Kathmandu, NP | 7 |
| Universidade Federal de Pelotaslocation not on record | 7 |
| UNICAMPlocation not on record | 7 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 6 |
| Castelar, AR | 6 |
| Uniwersytet Śląski w Katowicachlocation not on record | 6 |
| Palmerston North, NZ | 6 |
| Ivano-Frankivsk, UA | 6 |
| Chapingo, MX | 6 |
| MEXUlocation not on record | 6 |
| Foz do Iguaçu, BR | 6 |
| PRClocation not on record | 6 |
| Arequipa, PE | 6 |
| Hermosillo, MX | 6 |
| Loja, EC | 6 |
| Cambridge, US | 6 |
| Flagstaff, US | 6 |
| Frauenfeld, CH | 5 |
| KIWElocation not on record | 5 |
| WTUlocation not on record | 5 |
| Lake Charles, US | 5 |
| Chicago, US | 5 |
| Ural Federal University "B. N. Yeltsin"location not on record | 5 |
| Maringá, BR | 5 |
| Laboratorio de Ictiologialocation not on record | 5 |
| Université de Bordeauxlocation not on record | 5 |
| Ann Arbor, US | 5 |
| Pontifícia Universidade Católica do Paranálocation not on record | 5 |
| Feira de Santana, BR | 4 |
| Pullman, US | 4 |
| Palmerston, AU | 4 |
| UNESP-RClocation not on record | 4 |
| San Diego, US | 4 |
| Cuenca, EC | 4 |
| Uberlândia, BR | 4 |
| Davenport, US | 4 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 4 |
| Rotorua, NZ | 4 |
| Staten Island, US | 4 |
| TUR-Alocation not on record | 4 |
| Millersville, US | 4 |
| 云南省思茅市民族传统医药研究所location not on record | 4 |
| Changsha, CN | 4 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 4 |
| Smithsonian Institutionlocation not on record | 4 |
| Zhuzhou, CN | 4 |
| Trondheim, NO | 4 |
| Universidad Nacional de Colombia (UNAL)location not on record | 4 |
| Mlocation not on record | 4 |
| Dekalb, US | 4 |
| Davis, US | 4 |
| Tilburg, NL | 4 |
| Austin, US | 4 |
| ENTClocation not on record | 4 |
| UNESP-FCAlocation not on record | 4 |
| UTPLlocation not on record | 4 |
| Giardini Botanici Hanburylocation not on record | 3 |
| IWEP FEB RASlocation not on record | 3 |
| UTFPR-DVlocation not on record | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| BISHlocation not on record | 3 |
| Emporia, US | 3 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 3 |
| NoColllocation not on record | 3 |
| Culiacán, MX | 3 |
| Universidade Federale do Rio Grande do Sullocation not on record | 3 |
| Chengdu, CN | 3 |
| La Trobe Universitylocation not on record | 3 |
| Cambridge, US | 3 |
| Umeå Universitylocation not on record | 3 |
| New Brunswick, US | 3 |
| CEPLAClocation not on record | 3 |
| UFMSlocation not on record | 3 |
| Parkville, AU | 3 |
| Badajoz, ES | 3 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 3 |
| Fort Worth, US | 3 |
| Podgorica, ME | 3 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| Cascavel, BR | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Universidad de La Salle (La Salle)location not on record | 3 |
| Pondicherry, IN | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| UNESP, Campus São José Rio Prêtolocation not on record | 3 |
| Bloomington, US | 3 |
| Richmond, US | 3 |
| FUNEDlocation not on record | 3 |
| UEMlocation not on record | 3 |
| FUVATESlocation not on record | 3 |
| UoB-IBlocation not on record | 3 |
| CICYTEXlocation not on record | 3 |
| Porto Alegre, BR | 3 |
| Universidad Nacional de Asunciónlocation not on record | 3 |
| James Cook Townsvillelocation not on record | 2 |
| Fortaleza, BR | 2 |
| Western Carolina Universitylocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Corvallis, US | 2 |
| USFSlocation not on record | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| San Francisco, US | 2 |
| Herbier National du Gabonlocation not on record | 2 |
| UFPRlocation not on record | 2 |
| Valparaiso, CL | 2 |
| Xining, CN | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| Strecker Museum, Baylor Universitylocation not on record | 2 |
| Miami, US | 2 |
| Ensenada, MX | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| Forest Herbarium Ibadan (FHI)location not on record | 2 |
| Cenargenlocation not on record | 2 |
| Hangzhou, CN | 2 |
| Tampa, US | 2 |
| EMTCMlocation not on record | 2 |
| UFRPElocation not on record | 2 |
| Porvoo, FI | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Cochabamba, BO | 2 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 2 |
| Shanghai, CN | 2 |
| UNIVASFlocation not on record | 2 |
| Brasília, BR | 2 |
| Jinghong, CN | 2 |
| La Paz, MX | 2 |
| GZUlocation not on record | 2 |
| Mississippi State, US | 2 |
| Hanshan Normal Universitylocation not on record | 2 |
| UNESP-FCAVlocation not on record | 2 |
| Jyväskylä, FI | 2 |
| UFABClocation not on record | 2 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 2 |
| Washington, US | 2 |
| Odawara, JP | 2 |
| JGSlocation not on record | 2 |
| Philadelphia, US | 2 |
| National Biodiversity Institute, Costa Ricalocation not on record | 2 |
| Brasília, BR | 2 |
| Angwin, US | 2 |
| Dresden, DE | 2 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 2 |
| TAFORI-LSRClocation not on record | 2 |
| US | 2 |
| Batemans Bay, AU | 2 |
| Paleontological Collectionlocation not on record | 2 |
| Granada, ES | 2 |
| Université de Strasbourglocation not on record | 2 |
| Instituto de Investigação Científica Tropicallocation not on record | 2 |
| Northridge, US | 2 |
| Riobamba, EC | 2 |
| Zürich, CH | 2 |
| Tomioka, JP | 2 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 2 |
| McWane Science Centerlocation not on record | 2 |
| Universidad de Antioquia (UdeA)location not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| BSBIlocation not on record | 1 |
| La Paz, BO | 1 |
| Göteborg, SE | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| Salta, AR | 1 |
| Arusha, TZ | 1 |
| EAlocation not on record | 1 |
| Centro Cultural Santo Domingolocation not on record | 1 |
| Addis Ababa, ET | 1 |
| Ciudad de México, MX | 1 |
| Appalachian State Universitylocation not on record | 1 |
| Universidad Autónoma de Guadalajaralocation not on record | 1 |
| Mérida, MX | 1 |
| QCNElocation not on record | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Cusco, PE | 1 |
| Autlán de Navarro, MX | 1 |
| Jaén, ES | 1 |
| MHUlocation not on record | 1 |
| Philadelphia, US | 1 |
| DSMlocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Cenit Transporte y Logística de Hidrocarburos S.A.S. (CENIT)location not on record | 1 |
| US | 1 |
| Mendoza, AR | 1 |
| Viña del Mar, CL | 1 |
| Sevilla, ES | 1 |
| BClocation not on record | 1 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 1 |
| PUC-RIOlocation not on record | 1 |
| ROM007location not on record | 1 |
| UNESP-ISlocation not on record | 1 |
| Ilhéus, BR | 1 |
| Shanghai, CN | 1 |
| UESBlocation not on record | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| Minia, EG | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Mexico City, MX | 1 |
| Plocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| Shenyang Agricultural Universitylocation not on record | 1 |
| Guiyang, CN | 1 |
| The University of Arizonalocation not on record | 1 |
| Santa Maria, BR | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| MCNAMlocation not on record | 1 |
| San Luis Obispo, US | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| Zhengzhou, CN | 1 |
| Alcaldía Municipal de Garzón en Huilalocation not on record | 1 |
| Glarus, CH | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Jataí / Setor Industrial, BR | 1 |
| Honolulu, US | 1 |
| Otaru, JP | 1 |
| Sagamihara, JP | 1 |
| Tromso University Museumlocation not on record | 1 |
| Santa Teresa, BR | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Rishon Le Zion, IL | 1 |
| H-AkrKGlocation not on record | 1 |
| Vitoria, ES | 1 |
| CJBNlocation not on record | 1 |
| Henderson, US | 1 |
| BGBMlocation not on record | 1 |
| UFVJMlocation not on record | 1 |
| Sucre, BO | 1 |
| Missoula, US | 1 |
| Tokushima, JP | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Alicante, ES | 1 |
| TROMlocation not on record | 1 |
| Chapel Hill, US | 1 |
| Wollongong, AU | 1 |
| Quito, EC | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Guilin, CN | 1 |
| Coimbra, PT | 1 |
| QAUlocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| Tlalnepantla, MX | 1 |
| UFOPlocation not on record | 1 |
| Knoxville, US | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| UFSClocation not on record | 1 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 1 |
| Whitehorse, CA | 1 |
| Guangzhou, CN | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Logan, US | 1 |
| Montecillo, Texcoco, MX | 1 |
| Osaka, JP | 1 |
| Bourges, FR | 1 |
| Madrid, ES | 1 |
| Ivano-Frankove, UA | 1 |
| JMSlocation not on record | 1 |
| Linares, MX | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Kuopio, FI | 1 |
| nbflocation not on record | 1 |
| Peking Universitylocation not on record | 1 |
| Shanxi Universitylocation not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Antiguo Cuscatlán, SV | 1 |
| Tsukuba, JP | 1 |
| Turlock, US | 1 |
| San Sebastián, ES | 1 |
| Fulda, DE | 1 |
| BG-NMNHSlocation not on record | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Oswego, US | 1 |
| Portland, US | 1 |
| IAPlocation not on record | 1 |
| ESALQlocation not on record | 1 |
| Sanda, JP | 1 |
| IPA/SPlocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| Nijmegen, NL | 1 |
| Madison, US | 1 |
| Madrid, ES | 1 |
| University of Alberta Museumslocation not on record | 1 |
| JP | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| University of Johannesburglocation not on record | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| University of Papua New Guinealocation not on record | 1 |
| Universidade Tecnológica Federal do Paranálocation not on record | 1 |
| Campo Grande, BR | 1 |
| INMAlocation not on record | 1 |
| HNBlocation not on record | 1 |
| Toyama, JP | 1 |
| Universität Basel, Herbariumlocation not on record | 1 |
| Clocation not on record | 1 |
| QVMAGlocation not on record | 1 |
| Smithfield, AU | 1 |
| VENlocation not on record | 1 |
| UERJlocation not on record | 1 |
459 institutions · 9 911 of 10 685 vouchered records shown · 645 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA84 detections
Where the DNA of Galinsoga parviflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found84
Studies independent surveys2
Countries11
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 84 detections have coordinates
Open the map11 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median21.7 °C 15.4–23.6
Seasonal swing summer↔winter3.40 °C
Max temp (day)25.9 °C 20.5–27.8
Min temp (night)17.7 °C 10.4–19.5
Precipitation238 mm/mo 61.4–238
Air humidity61.1 % 58.9–62.1
Moisture balance87.7 mm/mo -48.7–87.7
Vapour deficit1,008 Pa 735–1,141
Wind speed3.00 m/s 2.40–3.30
Cloud cover53.7 % 30.5–56.0
CHELSA 1981–2010, ~9 km grid, at location & month of 81 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.