Galearis rotundifolia

(Banks ex Pursh) R.M.Bateman · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Galearis

At a glance

Occurrence records2 035

Data sources10

Biological traits10

DNA specimens20

eDNA detections9

Sources10 archives

Databases and archives Galearis rotundifolia's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 035 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF2 035 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceCCDB2n = 42

01Narrative

Galearis rotundifolia is a species of flowering plants in the orchid family, Orchidaceae. It is commonly called roundleaf orchis and small round-leaved orchid. It is a succulent perennial herb native to North America, where it occurs throughout Canada, part of the northern United States, and Greenland.Kew World Checklist of Selected Plant FamiliesAmerorchis rotundifolia. Flora of North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galearis rotundifolia has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes5

GenBank sequences10

eDNA detections9

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJN998913.1 ↗365 bpCanada · 2009

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCAGCTGGCCAAGGGCACGTCCGCCTGGGCGTCAAGCATT …

Amerorchis rotundifolia voucher 09PROBE-05207 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL3★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Galearis rotundifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidypolyploid inferred

Chromosome records42–422n range42median42mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 423×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — Love, A. & D. Love. 1981c. In Chromosome number reports LXXIII. Taxon 30: 845–851.

CCDB · book-ipcn66 — Love & Ritchie 1966

CCDB · book-ipcn67-71 — LOEVE, A., & w. SIMON. 1968. Cytotaxonomical notes on some American orchids. southw. Naturalist 13: 335-342.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 035 records

Wild obs. + sensor1 727

Museum / vouchered307

Cultivated / captive1

Range

Area of Occupancy AOO4 144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 804≤1 km 198≤10 km 95>10 km 333

1 430 georeferenced · 297 without coordinates

Open the mapobservation + sensor1 727

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 15≤1 km 52≤10 km 77>10 km 15

159 georeferenced · 148 without coordinates

Open the institutions mapphysical evidence307

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museumslocation not on record	80
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	59
Chicago, US	53
Université Lavallocation not on record	32
Montréal, CA	22
Bronx, US	12
Moscow State Universitylocation not on record	6
Ann Arbor, US	5
Churchill Northern Studies Centrelocation not on record	4
Québec, CA	4
Anchorage, US	3
Dekalb, US	3
University of Manitoba Herbariumlocation not on record	3
University of Lethbridgelocation not on record	2
MeiseBGlocation not on record	2
WINlocation not on record	2
Jurica-Suchy Nature Museumlocation not on record	1
Canadian Museum of Naturelocation not on record	1
Chicago, US	1
Whitewater, US	1
Denver, US	1
DOI/FWS, Kenai National Wildlife Refugelocation not on record	1
Madison, US	1
Christchurch, NZ	1

24 institutions · 300 of 307 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA9 detections

Where the DNA of Galearis rotundifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 8.70–13.2

Seasonal swing summer↔winter37.4 °C

Max temp (day)14.6 °C 12.5–18.0

Min temp (night)7.10 °C 6.10–9.30

Precipitation87.4 mm/mo 65.1–89.7

Air humidity62.1 % 59.6–63.6

Moisture balance-9.00 mm/mo

Vapour deficit485 Pa 413–619

Wind speed2.80 m/s

Cloud cover43.4 % 41.1–44.1

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Galearis rotundifolia

At a glance

Sources10 archives

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 035 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 24 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 035 records