Galbulimima belgraveana

(F.Muell.) Sprague · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Himantandraceae/Galbulimima

At a glance

Occurrence records306

Data sources12

Biological traits37

DNA specimens10

eDNA detections7

Sources12 archives

Databases and archives Galbulimima belgraveana's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility306 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Chemical compositionLOTUS20 compounds

Occurrence & distributionGBIF306 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Galbulimima belgraveana is a hallucinogenic plant. Its common names include agara and white magnolia. It is native to northeastern Australia, Malaysia, and Papua New Guinea. Papuans (who tend to use this drug the most) boil the bark and the leaves together with another plant, called Homalomena,Entheology.org - Preserving Ancient Knowledge in order to make tea. This tea leads to a deep sleep, in which it is said that vivid dreams and visions occur. The plant itself grows to about 90 feet, it has no petals and its flower are a yellow-brown colour. Several psychoactive alkaloids structurally related to himbacine, a muscarinic receptor antagonist, have been isolated from the plant, but the primary psychoactive constituent responsible for the plant's hallucinogenic effects has not yet been identified.sciencedirect The tree is also used for its wood.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology17

Fruit length22.5 mm

Fruit width23.5 mm

Leaf length120 mm

Leaf mass150 mg

Leaf mass per area44.5 g/m2

Leaf size2 240 mm²

Leaf width30 mm

Petiole length1.4 cm

Plant height40 m

⚠ sources differ — AusTraits: 40 m · TRY: 21.66 m

Seed length11 mm

Seed mass0.9 mg

Seed mass max0.9 mg

Seed mass min0.9 mg

Seed volume0.8 mm³

Seed volume max0.8 mm³

Seed volume min0.8 mm³

Seed width5.5 mm

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timennnnnnyyyyyn

Life formtree

Life spanperennial

Pollination syndromefly

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typefollicle

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate oblanceolate peltate

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density502 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition20 compounds

Compounds documented for Galbulimima belgraveana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Piperidine alkaloids5

Furanoid lignans3

Aromadendrane sesquiterpenoids2

Arylnaphthalene and aryltetralin lignans2

Quinolizidine alkaloids1

Documented compounds20 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Galbulin	present	LOTUS
(1aR,4S,4aS,7R,7aR,7bS)-1,1,4,7-tetramethyl-2,3,4a,5,6,7,7a,7b-octahydro-1aH-cyclopropa[e]azulen-4-ol	present	LOTUS
(1S,2S,3S,8R,12R,13R,16S,18R)-12-hydroxy-16-methyl-17-azapentacyclo[10.7.1.02,11.03,8.013,18]icos-10-en-9-one	present	LOTUS
(1S,2S,3S,8R,13S,16R,20R)-13-methyl-12-azapentacyclo[10.6.2.02,11.03,8.016,20]icos-10-ene-9,17-dione	present	LOTUS
(1S,2S,7S,12R,13R,15S)-13-[(2S,6S)-1-acetyl-6-methylpiperidin-2-yl]-7-hydroxy-12-methyl-11-oxatetracyclo[7.5.1.02,7.012,15]pentadec-8-en-10-one	present	LOTUS
(2S,3S,4S,5S)-2,5-bis(3,4-dimethoxyphenyl)-3,4-dimethyloxolane	present	LOTUS
(3S,3aR,4R,4aS,8aR,9aS)-3-Methyl-4-[(E)-2-((2S,6S)-6-methyl-piperidin-2-yl)-vinyl]-decahydro-naphtho[2,3-c]furan-1-one	present	LOTUS
(3S,3aR,4R,4aS,8aR,9aS)-3-methyl-4-[(E)-2-[(2R,6S)-6-methylpiperidin-2-yl]ethenyl]-3a,4,4a,5,6,7,8,8a,9,9a-decahydro-3H-benzo[f][2]benzofuran-1-one	present	LOTUS
(3S,3aR,4R,4aS,8aS)-4-[(E)-2-[(2R,6S)-1,6-dimethylpiperidin-2-yl]ethenyl]-3-methyl-3a,4,4a,5,6,7,8,8a-octahydro-3H-benzo[f][2]benzofuran-1-one	present	LOTUS
(5S,6S,7R)-5-(3,4-dimethoxyphenyl)-6,7-dimethyl-5,6,7,8-tetrahydrobenzo[f][1,3]benzodioxole	present	LOTUS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galbulimima belgraveana has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences5

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLMH826976.1 ↗553 bpPapua New Guinea · 2012

ACGT

AAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGC …

Galbulimima belgraveana voucher YAWPLANTCR203 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★rbcLatrnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Galbulimima belgraveana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — SAUER, w.. & F. EHRENDORFER. 1970. Chromosomen, Verwandtschaft and Evolution tropischer Holzpflanzen, II. Himantandraceae. Oesterr. Bot. z. 118: 38-54.

CCDB · book-ipcn67-71 — EHRENDORFER, F. , F. KRENDL, E. HABELER, & W. SAUER. 1968. Chromosome numbers and evolution in primitive Angiosperms. Taxon 17: 337-353.

n 121×CCDB · book-ipcn65

CCDB · book-ipcn65 — Raven & K. 1965

07Deep time~80.3 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin80.3 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard periods (Jurassic, Cretaceous…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. The dashed rules marked ✦ are the five great mass extinctions. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock originmass extinction

08Occurrence & distribution

Record type306 records

Wild obs. + sensor9

Museum / vouchered215

Other82

Origin

Native19

Range

Area of Occupancy AOO600 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy29% within 1 km

≤100 m 2≤10 km 2>10 km 3

7 georeferenced · 2 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 1≤1 km 17≤10 km 65>10 km 9

92 georeferenced · 123 without coordinates

Open the institutions mapphysical evidence215

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	67
Mount Annan, AU	19
Honolulu, US	17
Kew, GB	16
Zürich, CH	8
Smithfield, AU	7
University of Stellenboschlocation not on record	6
Museo Entomologico de Leonlocation not on record	4
South Kensington, GB	3
Bronx, US	2
Auckland, NZ	2
BISHlocation not on record	2
Monastir, TN	2
Palmerston, AU	2
Canberra, AU	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Saint Louis, US	1
University of Minnesotalocation not on record	1

19 institutions · 163 of 215 vouchered records shown · 51 without an institution code

09Environmental DNA7 detections

Where the DNA of Galbulimima belgraveana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.8 °C 19.0–21.9

Seasonal swing summer↔winter10.6 °C

Max temp (day)25.4 °C 23.4–27.9

Min temp (night)15.0 °C 14.5–17.7

Precipitation74.1 mm/mo 27.3–120

Air humidity61.0 % 46.9–65.5

Moisture balance-36.2 mm/mo -121–3.60

Vapour deficit869 Pa 832–1,473

Wind speed4.00 m/s 3.20–4.40

Cloud cover25.6 % 19.6–45.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)