Galatella sedifolia

(L.) Greuter · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Galatella

At a glance

Occurrence records9 914

Data sources11

Biological traits30

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Galatella sedifolia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 914 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources30 traits

Chemical compositionLOTUS8 compounds

Occurrence & distributionGBIF9 914 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Galatella sedifolia, often known by the synonym Aster sedifolius, is herbaceous perennial plant belonging to the genus Galatella of the family Asteraceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Fruit length3.75 mm

Fruit length max4 mm

Fruit length min3.5 mm

Plant height0.4 m

Plant height max1.2 m

Plant height min0.25 m

Seed mass0.564 mg

Seed mass max0.564 mg

Seed mass min0.564 mg

Life cycle & reproduction4

Flowering endAug

Flowering startAug

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max1 700 m

Elevation mean1 700 m

Elevation min1 700 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest edges, limestone, mountains, shrubberies, steppe

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry5

Leaf dry-matter content (LDMC)243 mg/g

Leaf n15.4 mg/g

Leaf p3.27 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)23.62 mm²/mg

03Chemical composition8 compounds

Compounds documented for Galatella sedifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols3

Anthocyanidins1

Gallotannins $ Simple phenolic acids1

Oleanane triterpenoids1

Flavones1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
2-(3,4-Dihydroxyphenyl)-5,7-dihydroxy-4-oxo-4H-1-benzopyran-3-yl 6-deoxyhexopyranoside	present	LOTUS
[(2S,3R,4S,5S)-4,5-dihydroxy-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl] (4aR,5R,6aR,6aS,6bR,8aR,10S,12aR,14bS)-10-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylate	present	LOTUS
Apigenin	present	LOTUS
Gallic acid	present	LOTUS
protocatechuate	present	LOTUS
Quercetin 3-alpha-D-galactoside	present	LOTUS
Vitamin P	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galatella sedifolia has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences7

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKP175232.1 ↗619 bpItaly · 1981

ACGT

TCGAGCCTGCAAGCAGACGACCGTGAACATGTTATAACAACCATGCCAGGATGGGTCGGGCGTTAGTTCGATCCTCGTGGCACACCGTCG …

Galatella sedifolia isolate A10 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa★ITS6

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Galatella sedifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–362n range20median18mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 185×CCDB · ita-fl · CCDB · iapt · CCDB · ipcn-api-dl +1

CCDB · ita-fl — GARBARI F., TORNADORE N. - 1972. Numeri cromosomici per la flora italiana:108-123.. Inform. Bot. Ital. , 4(1): 60-66.

CCDB · ita-fl — MONTI G., PAGNI A.M., VIEGI L. - 1978. Numeri cromosomici per la flora italiana:416-422.. Inform. Bot. Ital. , 10(1): 101-110.

CCDB · iapt — IAPT/IOPB Chromosome Data 11

CCDB · ipcn-api-dl — MONTI, G., A. M. PAGNI & L. VIEGI. 1978. Numeri cromosomici per la flora Italiana: 416-422. Inform. Bot. Ital. 10: 101–110.

CCDB · book-ipcn72 — GARBARI, F . & N TORNADORE. 1972. In Numeri cromosomici per la flora Italiana. Informatore Bot.--Ytal. 4: 45-66.

2n 365×CCDB · slov-fl · CCDB · iapt · CCDB · fl-europaea +1

CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.

CCDB · iapt — IAPT/IOPB Chromosome Data 11

CCDB · fl-europaea — Garbari &

CCDB · ipcn-api-dl — Malakhova, L. A. 1990. Kariologocheskij analiz prirodnykh populjacij redkich i ischezajushchikh rastenij na juge Tomskoj Oblasti. Bjulleten' Glavnogo Botanic|5eskogo Sada 155: 60–66.

CCDB · ipcn-api-dl — Rostovtseva, T. S. 1979a. Chromosome numbers of some species of the family Asteraceae Dumort. Bot. Zhurn. SSSR 64 (4): 582–589.

2n 201×CCDB · book-fedorov

CCDB · book-fedorov — COKOJIOBCKaH, CTpCJIKOBa 1948a

n 181×CCDB · ita-fl

CCDB · ita-fl — NEGODI G. - 1938. Cariologia del genere Aster L. (Compositae) I contributo.. Arch. Bot. (Forl) , 14(3-4): 185-216.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.998 ↗

08Occurrence & distribution

Record type9 914 records

Wild obs. + sensor9 692

Museum / vouchered132

Other90

Origin

Native2

Range

Area of Occupancy AOO14 684 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 3 974≤1 km 278≤10 km 2 593>10 km 47

6 892 georeferenced · 2 800 without coordinates

Open the mapobservation + sensor9 692

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 13≤1 km 12≤10 km 14

39 georeferenced · 93 without coordinates

Open the institutions mapphysical evidence132

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BDBClocation not on record	73
BClocation not on record	27
Granada, ES	7
Oulu, FI	3
Olocation not on record	3
Oskarshamn, SE	2
Philadelphia, US	2
LDlocation not on record	2
Finnish Museum of Natural History, Botanical Museumlocation not on record	1
Dresden, DE	1
CJBGlocation not on record	1
Turku, FI	1
Berlin, DE	1
Wlocation not on record	1
Montréal, CA	1
Museo Achille Folettolocation not on record	1
SLU Artdatabankenlocation not on record	1
Bern, CH	1
Muséum Henri Lecoqlocation not on record	1

19 institutions · 130 of 132 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Galatella sedifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 16.0–16.0

Seasonal swing summer↔winter22.4 °C

Max temp (day)19.2 °C

Min temp (night)13.0 °C

Precipitation89.1 mm/mo

Air humidity62.1 %

Moisture balance-6.50 mm/mo

Vapour deficit690 Pa

Wind speed3.40 m/s

Cloud cover44.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Galatella sedifolia

At a glance

Sources11 archives

Size & morphology9

Life cycle & reproduction4

Diet & foraging1

Habitat & environment11

Physiology & chemistry5

Compound class profile5 classes

Documented compounds8 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type9 914 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 914 records