Galanthus plicatus

M.Bieb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Galanthus

At a glance

Occurrence records2 472

Data sources13

Biological traits15

DNA specimens4

eDNA detections8

Sources13 archives

Databases and archives Galanthus plicatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 472 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS · NPASS17 compounds

Occurrence & distributionGBIF2 472 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB · GoaT27.1 Gbp

01Narrative

Galanthus plicatus est une espèce de la famille des Amaryllidaceae. Dénommé pleated snowdrop, cette espèce est originaire de l'Europe de l'Est et de l'Asie de l'Ouest. Il s'agit d'une plante herbacée bulbeuse pérenne à floraison printanière.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.3 m

Plant height min0.25 m

Life cycle & reproduction5

Flowering endApr

Flowering startMar

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, shrubberies

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition17 compounds

Compounds documented for Galanthus plicatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Amarylidaceae alkaloids14

Amarylidaceae alkaloids $ Phenylethylamines1

Phenylethylamines1

Documented compounds17 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Plicamine	present	LOTUS
(1S,12R,13S,16S,18S)-12-[2-(4-hydroxyphenyl)ethyl]-18-methoxy-15-methyl-5,7-dioxa-15-azapentacyclo[11.7.0.01,16.02,10.04,8]icosa-2,4(8),9-triene-11,14-dione	present	LOTUS
(1S,13R,16S,18S)-18-hydroxy-15-methyl-5,7,12-trioxa-15-azapentacyclo[11.7.0.01,16.02,10.04,8]icosa-2,4(8),9,19-tetraen-11-one	present	LOTUS
(1S,13S,16S,18S)-18-methoxy-15-methyl-5,7-dioxa-12,15-diazapentacyclo[11.7.0.01,16.02,10.04,8]icosa-2,4(8),9,11,19-pentaen-14-one	present	LOTUS
11-Hydroxyvittatine	present	LOTUS
20-Methyl-5,7,12-trioxa-20-azapentacyclo[11.4.3.01,13.02,10.04,8]icosa-2,4(8),9,16-tetraen-15-ol	present	LOTUS
[(1S,13S,16S,18S)-13-hydroxy-15-methyl-5,7,12-trioxa-15-azapentacyclo[11.7.0.01,16.02,10.04,8]icosa-2,4(8),9,19-tetraen-18-yl] (3S)-3-hydroxybutanoate	present	LOTUS
Galanthindole	present	LOTUS
Hordenine	present	LOTUS
IUSCMAAPQPVJOE-JVKGENMOSA-N	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galanthus plicatus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences10

eDNA detections8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU329697.1 ↗493 bp

ACGT

GGGGGTAGCAAATCCATGGCTTTTGCACCTTATGGTGCCCTTGTCATCGTCACCTTGCATGTTGTGTGGGATAGTTTGCAGGAACAAAGT …

Galanthus plicatus subsp. plicatus voucher ISTF:SYZB 2618 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL★ITS8

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Galanthus plicatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size27 090 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Galanthus plicatus27.09 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× diploid · measured

Chromosome records24–242n range24median24mode13records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2413×GoaT · Kew Plant DNA C-values Database · CCDB · nw-europe-fl · CCDB · fl-europaea +6

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4808

CCDB · fl-europaea — Van Loon &

CCDB · book-ipcn65 — Sveshnikova 1965

CCDB · book-ipcn67-71 — SVESHNIKOVA, L. I. 1967. Chromosome numbers of some species of Galanthus L. from South Europe and Asia Minor. (In Russian). Bot. Zhur. 52: 359-362.

CCDB · book-ipcn67-71 — Q26 SVESHNIKOVA, L.J. 1971. A comparative-karyological investigation of the genus Galanthus L. I. Section Galanthus. (In Russian). Bot. Zurn. 56: 118-126.

CCDB · book-ipcn75-78 — Loon & Oudemans 1976

CCDB · book-fedorov — La Cour (Darlington 1946)

CCDB · book-fedorov — CnemHHROBa JI. H. 1967

CCDB · book-atlas-flowering-plants — La Cour 1946

CCDB · book-atlas-flowering-plants — 1942

CCDB · kew — Zonneveld BJM, Grimshaw JM, Davis AP. 2003. The systematic value of nuclear DNA content in Galanthus. Plant Systematics and Evolution 241: 89-102.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 472 records

Wild obs. + sensor2 367

Museum / vouchered104

Cultivated / captive1

Origin

Introduced316

Range

Area of Occupancy AOO3 824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 1 154≤1 km 198≤10 km 589>10 km 17

1 958 georeferenced · 409 without coordinates

Open the mapobservation + sensor2 367

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 11≤1 km 23≤10 km 11

45 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence104

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	37
SLU Artdatabankenlocation not on record	4
BRNUlocation not on record	3
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	3
LDlocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Xiamen, CN	1
Mlocation not on record	1
Tartu, EE	1
Durham, US	1
SNSNMClocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
FLASlocation not on record	1
Saint Louis, US	1
Wlocation not on record	1

15 institutions · 59 of 104 vouchered records shown · 45 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Galanthus plicatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.50 °C 8.50–8.50

Seasonal swing summer↔winter24.2 °C

Max temp (day)12.5 °C

Min temp (night)4.60 °C

Precipitation50.0 mm/mo

Air humidity60.7 %

Moisture balance-26.6 mm/mo

Vapour deficit544 Pa

Wind speed4.20 m/s

Cloud cover51.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Galanthus plicatus

At a glance

Sources13 archives

Size & morphology2

Life cycle & reproduction5

Diet & foraging1

Habitat & environment6

Other traits1

Compound class profile3 classes

Documented compounds17 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type2 472 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions4 of 15 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 472 records