Galanthus nivalis
speciesAt a glance
Occurrence records179 483
Data sources15
Biological traits39
DNA specimens23
eDNA detections17
Sources15 archives
Databases and archives Galanthus nivalis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility179 483 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics23 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources39 traits
Chemical compositionLOTUS · NPASS39 compounds
Occurrence & distributionGBIF179 483 records
Environmental DNA1 datasets · 9 countries17 detections
DNA & barcodingBOLD · NCBI23 specimens
Genome at a glanceCCDB · GoaT34.1 Gbp
01Narrative
Galanthus nivalis, communément appelée Perce-neige, est une espèce de plantes herbacées vivaces à bulbe. Elle appartient à la famille des Liliaceae selon la classification classique ou des Amaryllidaceae selon la classification phylogénétique.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass46.75 mg
Leaf size521 mm²
⚠ sources differ — TRY: 521 mm² · LEDA: 1 404 mm² · GIFT: 1 404 mm²
Plant height0.14 m
⚠ sources differ — GIFT: 0.14 m · LEDA: 0.14 m · TRY: 0.175 m
Plant height generative0.14 m
Plant height max0.2 m
Plant height min0.07 m
Seed length4.02 mm
Seed mass6.59 mg
Seed mass max6.98 mg
Seed mass min6.11 mg
Life cycle & reproduction13
Deciduousnessvernal
⚠ sources differ — TRY: vernal · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeanimal
Flowering endApr
Flowering startFeb
Life formbulbous geophyte
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formcryptophyte
Reproduction asexualabsent
Seed number18
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Habitat GIFTforest
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)159 mg/g
⚠ sources differ — TRY: 159 mg/g · LEDA: 103 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)19.65 mm²/mg
⚠ sources differ — TRY: 19.65 mm²/mg · LEDA: 28.45 mm²/mg · GIFT: 28.45 mm²/mg
Other traits2
Diaspore typeseed
Plant support typefree-standing
03Chemical composition39 compounds
Compounds documented for Galanthus nivalis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Amarylidaceae alkaloids13
Aminoacids6
Amarylidaceae alkaloids $ Iridoids monoterpenoids $ Isoquinoline alkaloids1
Protoberberine alkaloids1
Acetate-derived alkaloids $ Polyamines1
Documented compounds39 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Galbacin | present | NPASS | |
| (-)-Galantamine | present | LOTUS | |
| (1S,13S,15R,18S)-5,7-dioxa-12-azapentacyclo[10.5.2.01,13.02,10.04,8]nonadeca-2,4(8),9,16-tetraene-15,18-diol | present | LOTUS | |
| (2S)-2-ammonio-3-(1H-imidazol-4-yl)propanoate | present | NPASS | |
| (S)-2-hydroxy-3-(1H-imidazol-4-yl)propanoic acid | present | NPASS | |
| 1-Propylamine | present | NPASS | |
| 3-Methyl-1-butylamine | present | NPASS | |
| 4-imidazoleacetate | present | NPASS | |
| [(1S,13S,15R,18R)-15-hydroxy-5,7-dioxa-12-azapentacyclo[10.5.2.01,13.02,10.04,8]nonadeca-2,4(8),9,16-tetraen-18-yl] (3S)-3-hydroxybutanoate | present | LOTUS | |
| [(1S,13S,15R,18R)-18-[(E)-but-2-enoyl]oxy-5,7-dioxa-12-azapentacyclo[10.5.2.01,13.02,10.04,8]nonadeca-2,4(8),9,16-tetraen-15-yl] (3S)-3-hydroxybutanoate | present | LOTUS |
05DNA & barcoding23 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galanthus nivalis has left across the world's sequence archives.
At a glance
DNA specimens23
Marker genes5
GenBank sequences10
eDNA detections17
Countries9
The DNA barcodea real sequence read deposited for this species
GAATCCTGGCTTTTGCACCTTATGGTGCCCTTGTCATCGTCACATTGCATGTTGTTGGGATAGTTTGCAGGAACAAAGTTTTGGTGTAGT …
Galanthus nivalis voucher A. Woerz 15.03.18.01 STU internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL2★rbcLa★ITS8★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Galanthus nivalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size34 093 080 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
WHEAT17 Gb
THIS GENOME Galanthus nivalis34.09 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× / 3× cytotypes
Chromosome records18–362n range24median24mode44records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2435×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +9
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — MICELI P., GARBARI F. - 1976. Numeri cromosomici per la flora italiana:255-262.. Inform. Bot. Ital. , 8(2): 207-216.
CCDB · ita-fl — D'AMATO G.F., BIANCHI G. - 1999. The chromosome banding of some Italian Amaryllidaceae.. Caryologia , 52(1-2): 87-92.
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · slov-fl — Mičieta K., 1981: Zytotaxonomische Probleme einiger Pflanzensippen des Javorníky - Gebirges. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 28: 95-104.
CCDB · fl-europaea — Stern, 1956
CCDB · poland — Skali?ska M., Pogan E., Jankun A. et al. 1968. Further studies in chromosome numbers of Polish Angiosperms. Seventh contribution. Acta Biol. Cracov. Ser. Bot. 11, 199-224.
CCDB · poland — Wcis?o unpubl. see Tura?a in Skali?ska M., Pogan E., Jankun A. et al. 1968. Further studies in chromosome numbers of Polish Angiosperms. Seventh contribution. Acta Biol. Cracov. Ser. Bot. 11, 199-224.
CCDB · book-ipcn65 — Sveshnikova 1985
CCDB · ipcn-api-dl — Krichphalushi, V. V. 1989. Sravnitelno-karyologicheskoe issledovanie prirodnykh populacij efemeroidov Karpat. Pp. 25--27 in Tesizy II Symp. Plant Karyology.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — D'Amato, G. F. & G. Bianchi. 1999. The chromosome banding of some Italian Amaryllidaceae. Caryologia 52: 87–92.
CCDB · ipcn-api-dl — Micieta, K. 1981. Zytotaxonomische probleme einiger Pflanzensippen des Javorniky-Gebirges. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 28: 95–104.
CCDB · ipcn-api-dl — Javurkova, V. 1980. In Chromosome number reports LXIX. Taxon 29: 713–714.
CCDB · ipcn-api-dl — Uhrikova, A. 1974a. In Index to chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.
CCDB · ipcn-api-dl — Dalgiç, G. & N. Basak. 1996. Chromosome numbers of some petaloid monocots from European Turkey. In M. A. Öztürk & al. (eds.), Plant Life in Southwest and Central Asia, 1: 54--62, Izmir.
CCDB · book-ipcn67-71 — SKALINSKA, M., E. POGAN, & A. JANKUN. 1968. Further studies in chromosome numbers of Polish Angiosperms, VII. Acta Biol. Cracov. Ser. Bot. 11: 199-224.
CCDB · book-ipcn67-71 — Q26 SVESHNIKOVA, L.J. 1971. A comparative-karyological investigation of the genus Galanthus L. I. Section Galanthus. (In Russian). Bot. Zurn. 56: 118-126.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-fedorov — La Cour (Darlington 1946)
CCDB · book-fedorov — CsennmKosa JI. H. 1967
CCDB · book-fedorov — Guignard 1891
CCDB · book-fedorov — Svensson-Stenar 1925
CCDB · book-fedorov — Heitz 1926
CCDB · book-fedorov — Geitler 1929b
CCDB · book-fedorov — TpBBl(OBCRHi 19300
CCDB · book-fedorov — Perry K. M. 1932
CCDB · book-fedorov — Delay 1947
CCDB · kew — Zonneveld BJM, Grimshaw JM, Davis AP. 2003. The systematic value of nuclear DNA content in Galanthus. Plant Systematics and Evolution 241: 89-102.
CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.
CCDB · CromoCat 2015 — Javurková, V. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 713-714.
CCDB · CromoCat 2015 — Popova, M. (1972b). Cytotaxonomic study of Bulgarian Galanthus Species. Compt. Rend. Acad. Bulg. Sci. 25: 377-380.
CCDB · CromoCat 2015 — Sveshnikova, L. (1971). Sravnitelnoe kariologiceskoe issiedovanie roda Galanthus L. I. Sekcija Galanthus . Bot. Žurn. 56: 118-126.
2n 365×GoaT · Kew Plant DNA C-values Database · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +2
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · book-ipcn67-71 — SVESHNIKOVA, L. I. 1967. Chromosome numbers of some species of Galanthus L. from South Europe and Asia Minor. (In Russian). Bot. Zhur. 52: 359-362.
CCDB · book-ipcn75-78 — Sveshnikova 1975
CCDB · kew — Zonneveld BJM, Grimshaw JM, Davis AP. 2003. The systematic value of nuclear DNA content in Galanthus. Plant Systematics and Evolution 241: 89-102.
CCDB · CromoCat 2015 — Fedorov, A. A. (1969). Chromosome numbers of flowering plants 7-927
2n 182×CCDB · book-ipcn73-74 · CCDB · CromoCat 2015
CCDB · book-ipcn73-74 — SUSNIK, F., & M. LOVKA. 1973. In IOPB chromosome number reports XLI. Taxon 22: 459-464.
CCDB · CromoCat 2015 — Susnik, F. & M. Lovka. (1973). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLI]. Taxon 22(4): 462-463.
2n 251×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Fedorov, A. A. (1969). Chromosome numbers of flowering plants 7-927
2n 261×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Miceli, P. & F. GARBARI. 1976. Numeri cromosomici per la flora Italiana: 255-262. Inform. Bot. Ital. 8: 207–216.
2n 281×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Fedorov, A. A. (1969). Chromosome numbers of flowering plants 7-927
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type179 483 records
Wild obs. + sensor175 127
Museum / vouchered3 722
Cultivated / captive18
Other616
Origin
Native482
Introduced7 442
Range
Area of Occupancy AOO235 224 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy56% within 1 km
≤100 m 59 356≤1 km 29 935≤10 km 68 820>10 km 1 809
159 920 georeferenced · 15 207 without coordinates
Open the mapobservation + sensor175 127
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy46% within 1 km
≤100 m 560≤1 km 483≤10 km 1 124>10 km 88
2 255 georeferenced · 1 467 without coordinates
Open the institutions mapphysical evidence3 722
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy19% within 1 km
≤100 m 1≤1 km 2≤10 km 1>10 km 12
16 georeferenced · 2 without coordinates
Open the mapnot free-living18
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions82 of 157 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 864 |
| LDlocation not on record | 224 |
| BIO-UNIPIlocation not on record | 179 |
| MeiseBGlocation not on record | 167 |
| SLU Artdatabankenlocation not on record | 151 |
| KMNlocation not on record | 103 |
| Oskarshamn, SE | 88 |
| Kew, GB | 84 |
| BFLlocation not on record | 69 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 63 |
| Bern, CH | 58 |
| Uppsala, SE | 56 |
| Olocation not on record | 55 |
| Görlitz, DE | 50 |
| Xiamen, CN | 48 |
| Adam Mickiewicz University in Poznańlocation not on record | 37 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 36 |
| Salzburg, AT | 36 |
| BDBClocation not on record | 31 |
| Provincia di Livornolocation not on record | 30 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 26 |
| Bronx, US | 20 |
| València, ES | 20 |
| BRNUlocation not on record | 20 |
| South Kensington, GB | 20 |
| GJOlocation not on record | 19 |
| Bergen, NO | 19 |
| Dresden, DE | 18 |
| DBF-NHMDlocation not on record | 17 |
| Tartu, EE | 16 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 16 |
| Barcelona, ES | 16 |
| BClocation not on record | 15 |
| Zürich, CH | 12 |
| MAlocation not on record | 11 |
| Karlsruhe, DE | 11 |
| Wlocation not on record | 11 |
| Porrentruy, CH | 11 |
| Zürich, CH | 10 |
| Regensburgische Botanische Gesellschaftlocation not on record | 10 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 10 |
| Vancouver, CA | 9 |
| Moscow State Universitylocation not on record | 9 |
| Bourges, FR | 8 |
| Trondheim, NO | 8 |
| Saint Louis, US | 8 |
| Charleston Southern Universitylocation not on record | 8 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 7 |
| Natural History Museum Rotterdamlocation not on record | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 6 |
| McWane Science Centerlocation not on record | 6 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 6 |
| Salamanca, ES | 6 |
| San Sebastián, ES | 6 |
| Tilburg, NL | 6 |
| Mlocation not on record | 5 |
| Palacký University in Olomouclocation not on record | 5 |
| Frankfurt am Main | 5 |
| Auckland, NZ | 5 |
| Entomological Society of Latvialocation not on record | 5 |
| Chongqing Museumlocation not on record | 5 |
| SZUlocation not on record | 5 |
| Berlin, DE | 5 |
| University of Stellenboschlocation not on record | 4 |
| TROMlocation not on record | 4 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 4 |
| UGentlocation not on record | 4 |
| WTUlocation not on record | 4 |
| Ann Arbor, US | 3 |
| Millersville, US | 3 |
| Stockholm, SE | 3 |
| Pullman, US | 3 |
| Tallinn, EE | 3 |
| CJBNlocation not on record | 3 |
| Royal Botanic Garden Edinburghlocation not on record | 2 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 2 |
| Tampa, US | 2 |
| Boumlocation not on record | 2 |
| ER Hellerlocation not on record | 2 |
| Alicante, ES | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Pamplona, ES | 2 |
| Vitoria, ES | 2 |
| Columbia, US | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Brussel, BE | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Granada, ES | 2 |
| Lausanne, CH | 2 |
| LfUlocation not on record | 2 |
| Denver, US | 2 |
| Muséum Henri Lecoqlocation not on record | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| Tromso University Museumlocation not on record | 2 |
| NBSIlocation not on record | 2 |
| Helsinki, FI | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Madrid, ES | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Davenport, US | 1 |
| Porto Alegre, BR | 1 |
| CJBGlocation not on record | 1 |
| Portland, US | 1 |
| H-Wolflocation not on record | 1 |
| Claremont, US | 1 |
| Bando, JP | 1 |
| Dekalb, US | 1 |
| Riverside, US | 1 |
| Fribourg, CH | 1 |
| Hobart, AU | 1 |
| Nijmegen, NL | 1 |
| Burlington, US | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Allentown, US | 1 |
| IPE-CSIClocation not on record | 1 |
| Banyoles, ES | 1 |
| Toronto, CA | 1 |
| Firenze, IT | 1 |
| Corvallis, US | 1 |
| Fulda, DE | 1 |
| Santiago de Compostela, ES | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| Mexico City, MX | 1 |
| College Park, US | 1 |
| Podgorica, ME | 1 |
| UBT-Kaullocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Madison, US | 1 |
| Oswego, US | 1 |
| SNSNMClocation not on record | 1 |
| Jaén, ES | 1 |
| Philadelphia, US | 1 |
| Saint John, CA | 1 |
| Knoxville, US | 1 |
| Christchurch, NZ | 1 |
| UFRRJlocation not on record | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| Northridge, US | 1 |
| Frauenfeld, CH | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| Monastir, TN | 1 |
| PRClocation not on record | 1 |
| Provo, US | 1 |
| GZUlocation not on record | 1 |
| Boise, US | 1 |
| Edinburgh, GB | 1 |
| LINUlocation not on record | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Paris, FR | 1 |
| Mohonk Preservelocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| New Haven, US | 1 |
| Bloomington, US | 1 |
| University of Bayreuthlocation not on record | 1 |
157 institutions · 3 041 of 3 722 vouchered records shown · 675 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA17 detections
Where the DNA of Galanthus nivalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found17
Studies independent surveys1
Countries9
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 17 detections have coordinates
Open the map9 countries0
Residential garden; in flower bedOpen ash woodland; on forest floor
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median6.90 °C 3.80–15.1
Seasonal swing summer↔winter16.2 °C
Max temp (day)12.4 °C 5.40–18.8
Min temp (night)3.60 °C 0.5–9.30
Precipitation68.1 mm/mo 56.3–89.5
Air humidity62.8 % 55.7–65.4
Moisture balance-8.00 mm/mo -45.4–30.5
Vapour deficit447 Pa 277–777
Wind speed4.00 m/s 2.40–6.40
Cloud cover47.2 % 38.8–59.1
CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.