Galanthus lagodechianus

Kem.-Nath. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Galanthus

At a glance

Occurrence records105

Data sources10

Biological traits13

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Galanthus lagodechianus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility105 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF105 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT80.3 Gbp

01Narrative

Galanthus lagodechianus est une espèce de plantes herbacées vivaces à bulbe de la famille des Amaryllidaceae. C'est l'une des espèces dont le nom vernaculaire anglais est Snowdrop. Il a été découvert dans le Caucase.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass8.1 mg

Seed mass max7.71 mg

Seed mass min7.71 mg

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galanthus lagodechianus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY101301.1 ↗649 bp

ACGT

GGATCATTGTTGAGACCTGAATGAACGATAGCTAACTTGTAATGCACCTATGGGGAGAATGTAGTGGGGGTACCAAATCCATGGCCTTTG …

Galanthus lagodechianus internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Galanthus lagodechianus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size80 342 700 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Galanthus lagodechianus80.34 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 72 n = 36

Ploidy6× hexaploid · measured

Chromosome records72–722n range72median72mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 7210×GoaT · Kew Plant DNA C-values Database · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-ipcn65 — Sveshnikova 1965

CCDB · ipcn-api-dl — Sveshnikova, L. I. 1988. Chromosome numbers in some members of the Amaryllidaceae, Liliaceae, Ranunculaceae, Asteraceae in the flora of the USSR. Bot. Žhurn. (Moscow & Leningrad) 73: 1358–1359.

CCDB · ipcn-api-dl — Gabrielian. 2002. On the morphology and karyology of the species of Galanthus in Armenia. Fl. Rastitel'n. Rastitel'n. Resursy Armenii 14: 48–53.

CCDB · book-fedorov — CnemHHKOBa JI. H. 1967

CCDB · book-fedorov — CsennmKosa JI. H. 1965

CCDB · kew — Zonneveld BJM, Grimshaw JM, Davis AP. 2003. The systematic value of nuclear DNA content in Galanthus. Plant Systematics and Evolution 241: 89-102.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

hexaploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type105 records

Wild obs. + sensor61

Museum / vouchered38

Cultivated / captive6

Range

Area of Occupancy AOO216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 16≤1 km 11≤10 km 7>10 km 9

43 georeferenced · 18 without coordinates

Open the mapobservation + sensor61

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 7>10 km 1

8 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence38

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 5 without coordinates

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institute of Botany, Ilia State Universitylocation not on record	23
Moscow State Universitylocation not on record	12
Xiamen, CN	1
Edinburgh, GB	1

4 institutions · 37 of 38 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Galanthus lagodechianus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.7 °C 10.7–10.7

Seasonal swing summer↔winter22.1 °C

Max temp (day)15.0 °C

Min temp (night)5.70 °C

Precipitation112 mm/mo

Air humidity62.4 %

Moisture balance32.0 mm/mo

Vapour deficit551 Pa

Wind speed4.00 m/s

Cloud cover43.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)