Galactia smallii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Galactia

At a glance

Occurrence records25

Data sources6

Biological traits6

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Galactia smallii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility25 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF25 records

DNA & barcodingNCBIsequences

01Narrative

Galactia smallii is a rare species of flowering plant in the legume family known by the common name Small's milkpea. It is endemic to Florida, where it is known only from a few small patches of remaining habitat in Miami-Dade County.Galactia smallii. The Nature Conservancy. It is threatened by the destruction and inadequate management of its habitat. It was federally listed as an endangered species of the United States in 1985.USFWS. Endangered and threatened status for five Florida pine rockland plants. Federal Register July 18, 1985.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment4

Climatesubtropical

Climberobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Climber

Woodinessnon-woody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Galactia smallii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMH549864.1 ↗560 bpUSA

ACGT

AAAGCAAGTGTTGGGTTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTG …

Galactia smallii voucher Trotta950134 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL2

plant barcode

08Occurrence & distribution

Record type25 records

Wild obs. + sensor16

Museum / vouchered9

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 16

16 georeferenced

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 7

8 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Miami, US	7
Bronx, US	1

2 institutions · 8 of 9 vouchered records shown · 1 without an institution code