Gaillardia suavis

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Gaillardia

At a glance

Occurrence records2 260

Data sources11

Biological traits10

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Gaillardia suavis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 260 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF2 260 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 76

01Narrative

Gaillardia suavis is a species of flowering plant in the sunflower family, common names pincushion daisyExcerpts from Jim Conrad's Naturalist Newsletter, Backyard Nature, Pincushion Daisies includes photos and perfumeballs. It is native to northern Mexico (Coahuila, Nuevo León, Tamaulipas)Turner, B. L. 2013. The comps of Mexico. A systematic account of the family Asteraceae (chapter 11: tribe Helenieae). Phytologia Memoirs 16: 1–100 and the southern Great Plains of the United States (Kansas, Oklahoma, Texas).Biota of North America Program 2014 county distribution map Gaillardia suavis grows in limestone or sandy soils in prairies, desert scrub, or open juniper woodlands. It is a perennial herb up to 80 cm tall, with leaves crowded around the base rather than borne on the stem. Each flower head is on its own flower stalk up to 75 cm long. Each head generally has 7-10 red or purple ray flowers, though some heads have no ray flowers. The center of the head has 40-100 pink or purple disc flowers.Flora of North America, Gaillardia suavis (A. Gray & Engelmann) Britton & Rusby, 1887.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology3

Seed mass2.59 mg

Seed mass max2.59 mg

Seed mass min2.59 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition4 compounds

Compounds documented for Gaillardia suavis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Isoflavones3

Unsaturated fatty acids1

Documented compounds4 total

Compound	Amount	Source
5,6-Dihydroxy-3-(4-hydroxy-3-methoxyphenyl)-7-methoxychromen-4-one	present	LOTUS
5,6-Dihydroxy-3-(4-hydroxyphenyl)-7-methoxychromen-4-one	present	LOTUS
7,3'-Di-O-methylorobol	present	LOTUS
Linonelic acid	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gaillardia suavis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences4

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSDQ391223.1 ↗622 bp

ACGT

GAACAAGTACCTACAATGCGGCTTTTTGGGTTTCAGGCTTTTGGTTTGATACTCGGGAAGCGTTGCTACCATGTGTTCATGAACTCTTTT …

Gaillardia suavis voucher Buthod & Fagin AB-2222 (OKL) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS4ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Gaillardia suavis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 76 n = 38

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 151×CCDB · Cave1956supp

CCDB · Cave1956supp — Biddulph 1944

n 191×CCDB · book-ipcn72

CCDB · book-ipcn72 — TURNER, B.L. 1972. Two new gypsophilous species of Gaillardia (Compositael from north-central Mexico. Southw. Naturalist 17: 181-190.

n 381×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Urbatsch, L. E. 1975. First chromosome number reports for some Compositae. S. W. Naturalist 19: 283–285.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 260 records

Wild obs. + sensor1 622

Museum / vouchered633

Other5

Origin

Native1

Range

Area of Occupancy AOO5 664 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 991≤1 km 158≤10 km 57>10 km 126

1 332 georeferenced · 290 without coordinates

Open the mapobservation + sensor1 622

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 63≤1 km 109≤10 km 219>10 km 36

427 georeferenced · 206 without coordinates

Open the institutions mapphysical evidence633

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions33 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Austin, US	179
Fort Worth, US	144
Wuzhou, CN	71
Bronx, US	68
Lubbock, US	26
Denton, US	23
Torreón, MX	11
EL PASO, US	10
Riverside, US	9
Bangkok, TH	7
Stephenville, US	7
Pullman, US	6
Durango, MX	6
Mexico City, MX	5
Bloomington, US	5
Chongqing Museumlocation not on record	5
Saint Louis, US	5
BAYLUlocation not on record	4
Emporia, US	4
Austin, US	4
Pittsburg, US	3
San Angelo, US	3
Burlington, US	3
Texas Lutheran Universitylocation not on record	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Boise, US	2
San Luis Obispo, US	2
Davis, US	1
AUAlocation not on record	1
Waverly, US	1
Chadron, US	1
Moscow, US	1
Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record	1
Phoenix, US	1
Wlocation not on record	1
Baltimore, US	1
Albuquerque, US	1
Canadian Department of Agriculturelocation not on record	1
University of Stellenboschlocation not on record	1
Tempe, US	1
Provo, US	1
ASUlocation not on record	1
Edmonton, CA	1

43 institutions · 633 of 633 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Gaillardia suavis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources11 archives

Size & morphology3

Life cycle & reproduction1

Diet & foraging1

Habitat & environment5

Compound class profile2 classes

Documented compounds4 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 260 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions33 of 43 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 260 records