Gaillardia spathulata

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Gaillardia

At a glance

Occurrence records270

Data sources12

Biological traits10

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Gaillardia spathulata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility270 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Chemical compositionLOTUS · NPASS12 compounds

Occurrence & distributionGBIF270 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Gaillardia spathulata, the western blanketflower, is a species of flowering plant in the sunflower family.The Plant List, Gaillardia spathulata A. Gray It is native to the western United States (Utah, western Colorado, and northwestern Arizona, with an isolated population reported from central Kansas).Biota of North America Program 2014 county distribution mapSEINet, Southwestern Biodiversity, Arizona Chapter, Gaillardia spathulata photos, description, distribution map Gaillardia spathulata grows in clay sandy washes often in desert regions. It is an annual herb up to 35 cm tall, with leaves on the stem rather than crowded around the base. Each flower head is on its own flower stalk up to 10 cm long. Each head has 7-10 yellow ray flowers surrounding 60-100 yellow disc flowers.Flora of North America, Gaillardia spathulata A. Gray, 1876.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology3

Seed mass3.11 mg

Seed mass max3.11 mg

Seed mass min3.11 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition12 compounds

Compounds documented for Gaillardia spathulata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Taraxerane triterpenoids2

Pseudoguaiane sesquiterpenoids2

Lupane triterpenoids1

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
[(3aR,4R,5S,5aS,6S,8R,8aS,9R,9aS)-4,8,9-trihydroxy-5,8a-dimethyl-1-methylidene-2-oxo-4,5,5a,6,7,8,9,9a-octahydro-3aH-azuleno[6,5-b]furan-6-yl] 3-methylbutanoate	present	LOTUS
DEQAVSIRSXMHPJ-FMSLPZACSA-N	present	NPASS
DEQAVSIRSXMHPJ-JGDQQYQGSA-N	present	NPASS
HPFQTBIDEWNXED-RXLNSLBGSA-N	present	NPASS
HPFQTBIDEWNXED-ZJOWZQDHSA-N	present	NPASS
Lupeol	present	NPASS
MLFJKLDXLNGGBA-FZNWAETBSA-N	present	NPASS
Spathulin	present	LOTUS
Taraxerol	present	NPASS
Taraxerone	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gaillardia spathulata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSDQ391221.1 ↗615 bp

ACGT

GAACAAGTACCTACAATGCGGCTTTTTGGGTTTCGGGCTTTTCGTTCGAGACTCGGGAAGCCTTGCTACCGTGTGTTGATGACTTCCTTT …

Gaillardia spathulata voucher Hufford 3944 (WS) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Gaillardia spathulata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–342n range28median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dJ spermatophyta de Portugal. 47(Ser. 2l: 299-314. II Compositae, supl. I Bol. Soc. Brot. I

2n 341×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type270 records

Wild obs. + sensor90

Museum / vouchered180

Range

Area of Occupancy AOO744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 43≤1 km 8≤10 km 1>10 km 15

67 georeferenced · 23 without coordinates

Open the mapobservation + sensor90

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 6≤1 km 12≤10 km 10>10 km 2

30 georeferenced · 150 without coordinates

Open the institutions mapphysical evidence180

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provo, US	43
Bronx, US	42
Pullman, US	14
Orem, US	11
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	7
DOI/NPS, Colonial National Historical Parklocation not on record	7
Moscow, US	5
Flagstaff, US	5
US	5
Riverside, US	5
University of Stellenboschlocation not on record	4
Musee des Dinosaures d'Esperaza (Aude)location not on record	4
Denver, US	4
Logan, US	3
Wuzhou, CN	3
Claremont, US	2
Phoenix, US	2
Durango, US	2
Emporia, US	1
Mexico City, MX	1
Rocky Mountain Biological Laboratorylocation not on record	1
Henderson, US	1
Boise, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
San Diego, US	1
Clemson, US	1
SEINetlocation not on record	1
DOI/NPS, Greenbelt Parklocation not on record	1
Bloomington, US	1

29 institutions · 179 of 180 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Gaillardia spathulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)