Gaillardia pulchella
Foug. · speciesAt a glance
Occurrence records43 387
Data sources14
Biological traits111
DNA specimens24
eDNA detections17
Sources14 archives
Databases and archives Gaillardia pulchella's data was compiled from.
WikipediaWikimedia Foundation10 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility43 387 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics24 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources111 traits
Chemical compositionLOTUS · NPASS114 compounds
Occurrence & distributionGBIF43 387 records
Environmental DNA1 datasets · 2 countries17 detections
DNA & barcodingBOLD · NCBI24 specimens
Genome at a glanceCCDB · GIFT2n = 34
01Narrative
Gaillardia pulchella (firewheel, Indian blanket, Indian blanketflower, or sundance), is a North American species of short-lived perennial or annual flowering plants in the sunflower family.Turner, B. L. 2013. The comps of Mexico. A systematic account of the family Asteraceae (chapter 11: tribe Helenieae). Phytologia Memoirs 16: 1–100Jørgensen, P. M., M. H. Nee & S. G. Beck. (eds.) 2014. Catálogo de las plantas vasculares de Bolivia, Monographs in systematic botany from the Missouri Botanical Garden 127(1–2): i–viii, 1–1744Nelson, C. H. 2008. Catálogo de las Plantas Vasculares de Honduras 1–1576. Secretaria de Recursos Naturales y Ambiente, TegucigalpaGibbs Russell, G. E., W. G. M. Welman, E. Retief, K. L. Immelman, G. Germishuizen, B. J. Pienaar, M. Van Wyk & A. Nicholas. 1987. List of species of southern African plants. Memoirs of the Botanical Survey of South Africa 2(1–2): 1–152(pt. 1), 1–270(pt. 2).Flora of China, Gaillardia pulchella Fougeroux, 1788. 天人菊 tian ren juUnited States Department of Agriculture Plant Pro
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology16
Fruit length2.75 mm
⚠ sources differ — AusTraits: 2.75 mm · GIFT: 2 mm
Fruit length max2 mm
Fruit length min2 mm
Leaf length40 mm
⚠ sources differ — AusTraits: 40 mm · GIFT: 75 mm
Leaf length max100 mm
Leaf length min20 mm
Leaf width10 mm
Leaf width max30 mm
Leaf width min4 mm
Petiole length0.5 cm
Plant height0.505 m
⚠ sources differ — GIFT: 0.505 m · AusTraits: 0.6 m · USDA: 0.61 m · TRY: 0.555 m
Plant height max0.6 m
Plant height min0.1 m
Seed mass1.77 mg
Seed mass max2.3 mg
Seed mass min1.1 mg
Life cycle & reproduction25
Bloom periodIndeterminate
Coppice potentialNo
Dehiscenceindehiscent
Flower colourpurple
⚠ sources differ — GIFT: violet · USDA: Yellow
Flower conspicuousYes
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formannual
Life spanannual/perennial
⚠ sources differ — TRY: annual/perennial · AusTraits: annual · GIFT: annual
Lifespan categoryShort
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formtherophyte
Resprout abilityNo
Seed spread rateRapid
Seedling vigorHigh
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment30
Active growth periodSpring, Summer, Fall
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max1 345 m
Elevation mean2 550 m
Elevation min5 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourblack
Fruit typeachene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: Subshrub, Forb/herb
Growth form USDASingle Crown
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Leaf shapeelliptical lanceolate
Low growing grassNo
Root depth min12 in
Shape and orientationDecumbent
Small grainNo
Woodinessvariable
⚠ sources differ — TRY: non-woody/woody · AusTraits: herbaceous · GIFT: non-woody
Physiology & chemistry19
Anaerobic toleranceNone
C:N ratioMedium
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementMedium
Fire resistantNo
Fire toleranceNone
Frost free days min160 days
Moisture useMedium
Nitrogen fixation levelNone
Precipitation max18 in
Precipitation min7 in
Protein potentialMedium
Salinity toleranceNone
Shade toleranceHigh
Soil pH max8.5 pH
Soil pH min7 pH
Temperature min32 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound238 144 per lb
ToxicityNone
Veneer productNo
Other traits5
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Shoot orientationascending
03Chemical composition114 compounds
Compounds documented for Gaillardia pulchella across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Pseudoguaiane sesquiterpenoids38
Guaiane sesquiterpenoids9
Germacrane sesquiterpenoids9
Quinolizidine alkaloids7
Eudesmane sesquiterpenoids5
Documented compounds114 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-Gaillardin | present | LOTUS | |
| (-)-Lycopodine | present | NPASS | |
| (1R,2R,13R,15R)-11-hydroxy-15-methyl-6-azatetracyclo[8.6.0.01,6.02,13]hexadec-10-en-12-one | present | NPASS | |
| (1R,2R,3R,6S,8S,9R)-1,9-dihydroxy-3,8-dimethyltricyclo[4.4.0.02,8]decan-5-one | present | LOTUS | |
| (1R,9S,10R,16R)-14,16-dimethyl-6,14-diazatetracyclo[7.5.3.01,10.02,7]heptadeca-2(7),3,5-triene | present | NPASS | |
| (1S,3aS,5R,5aS,6S,8R,8aS,9aR)-6,8-dihydroxy-5,8a-dimethyl-1-(piperidin-1-ylmethyl)-1,3a,4,5,5a,6,7,8,9,9a-decahydroazuleno[6,5-b]furan-2-one | present | LOTUS | |
| (2R,9S,11R,12R,14R,16S)-14-methyl-1,4-diazapentacyclo[7.7.1.02,12.03,8.011,16]heptadec-3(8)-en-5-one | present | NPASS | |
| (3aR,5aR,6S,7R,8aS,9aR)-6,7-dihydroxy-8a-methyl-1,5-dimethylidene-3a,4,5a,6,7,8,9,9a-octahydroazuleno[6,5-b]furan-2-one | present | LOTUS | |
| (3aR,5R,5aS,6S,8R,8aS,9S,9aS)-6,8,9-trihydroxy-5,8a-dimethyl-1-methylidene-4,5,5a,6,7,8,9,9a-octahydro-3aH-azuleno[6,5-b]furan-2-one | present | LOTUS | |
| (3aR,5R,5aS,6S,8S,8aS,9aR)-6,8-dihydroxy-5,8a-dimethyl-1-methylidene-4,5,5a,6,7,8,9,9a-octahydro-3aH-azuleno[6,5-b]furan-2-one | present | LOTUS |
05DNA & barcoding24 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gaillardia pulchella has left across the world's sequence archives.
At a glance
DNA specimens24
Marker genes8
GenBank sequences10
eDNA detections17
Countries2
The DNA barcodea real sequence read deposited for this species
ACGCATCAAAACGCTCCCATCATCCTCCCTTTAAGGGACGGATGCGTCATGGGGCGGAGATTGGTCTCCTGTGCTGTTTGTGTAGTTGGC …
Gaillardia pulchella voucher ZY-19 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL4★rbcLa★ITS3★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT
The complete instruction manual Gaillardia pulchella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 34 n = 17
Ploidy2× diploid · measured
Chromosome records24–682n range34median34mode24records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3418×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · eflora +4
CCDB · ipcn-api-dl — Wang, X. l. & M. x. Li. 1987. Observation of chromosomes on 10 composite species. J. Wuhan Bot. Res. 5: 111–117.
CCDB · ipcn-api-dl — Nirmala, A. & P. N. Rao. 1984. Karyotype studies in Asteraceae. Cell Chromosome Res. 7: 26–28.
CCDB · ipcn-api-dl — Nirmala, A. & P. N. Rao. 1989. Karyotype studies in some Asteraceae. Cell Chromosome Res. 12: 17–18.
CCDB · ipcn-api-dl — Nirmala, A. & P. N. Rao. 1981. In Chromosome number reports LXX. Taxon 30: 78.
CCDB · ipcn-api-dl — Stoutamire, W. 1977. Chromosome races of Gaillardia pulchella (Asteraceae). Brittonia 29: 297–309.
CCDB · ipcn-api-dl — Peng, C. i. & C. c. Hsu. 1977. In IOPB chromosome number reports LVIII. Taxon 26: 557–565.
CCDB · ipcn-api-dl — Zhao, Z. 1996. Documented chromosome numbers 1996:2. Miscellaneous U. S. A. and Mexican species, mostly Asteraceae. Sida 17(1): 259–263.
CCDB · book-indian_vol1 — Biddulph, S.F. 1944 ; Schnack, B. & Fernandez, O. 1946; Stoutamire, W.P. 1955, 1960 ; Mehra, P.N. et al. 1965 ; Jones, S. B. Jr 1970 ; Urbatsch, L.E. 1974 ; Peng, C.-I. & Hsu, C.-C. 1977 ; Keil, D.J. & Pinkava, D.J. 1976 ; Peng, C.-I. & Hsu, C.-C. 1978
CCDB · book-indian_vol1 — Jash, M. 1967
CCDB · eflora
CCDB · book-fedorov — Biddulph 1944
CCDB · book-fedorov — I. 1956)
CCDB · book-fedorov — Schnack, Fernandez 1946
CCDB · book-fedorov — Stoutamire 1955, 1960
CCDB · book-fedorov — Mehra P. N. et al.1965
CCDB · Cave1956supp — Stoutamire 1955
CCDB · Cave1958 — Stoutamire 1958
GIFT · GIFT (floras)
2n 364×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants +1
CCDB · book-indian_vol1 — Morinaga, T. et al. 1929
CCDB · book-fedorov — Morinaga et al. 1929
CCDB · book-atlas-flowering-plants — Morinaga et al. '29
GIFT · GIFT (floras)
2n 241×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang & C. b. Chen. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press, Beijing.
2n 681×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 1716×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +3
CCDB · book-ipcn65 — Mehra et al. 1965
CCDB · ipcn-api-dl — Razaq, Z. A., S. Khatoon & S. I. Ali. 1988. A contribution to the chromosome numbers of Compositae from Pakistan. Pakistan J. Bot. 20: 177–189.
CCDB · ipcn-api-dl — Ward, D. E. 1983. Chromosome counts from New Mexico and southern Colorado. Phytologia 54: 302–309.
CCDB · ipcn-api-dl — Gill, L. S. & I. D. Omoigui. 1987. The incidence of polyploidy in family Asteraceae in southern Nigeria. Rev. Cytol. Biol. Vég., Bot. 10: 177–184.
CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1989. Cytopalynology of north and central Indian Compositae. J. Cytol. Genet. 24: 96–105.
CCDB · ipcn-api-dl — Razaq, Z. A., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800–808.
CCDB · ipcn-api-dl — Nirmala, A. & P. N. Rao. 1981. In Chromosome number reports LXX. Taxon 30: 78.
CCDB · ipcn-api-dl — Powell, A. M., D. W. KYHOS & P. H. Raven. 1975. Chromosome numbers in Compositee. XI. Helenieae. Amer. J. Bot. 62: 1100–1103.
CCDB · ipcn-api-dl — Keil, D. J. & D. J. Pinkava. 1976. Chromosome counts and taxonomic notes for Compositae from the United States and Mexico. Amer. J. Bot. 63: 1393–1403.
CCDB · ipcn-api-dl — Keil, D. J. & T. F. Stuessy. 1975. Chromosome counts of Compositae from the United States, Mexico and Guatemala. Rhodora 77: 171–195.
CCDB · book-ipcn72 — TURNER, B.L. 1972. Two new gypsophilous species of Gaillardia (Compositael from north-central Mexico. Southw. Naturalist 17: 181-190.
CCDB · book-ipcn67-71 — JONES, S.B., JR. 1970. Chromosome numbers in Compositae. Bull. Torrey Bot. Club. 97: 168-174.
CCDB · book-ipcn73-74 — WATSON, T.J., Jr. 1973. Chromosome numbers in Compositae from the southwestern United states. Southw. Naturalist 18: 117-124.
CCDB · book-ipcn73-74 — URBATSCH, L.E. 1974. In IOPB chromosome number reports XLIV. Taxon 23: 373-380.
CCDB · Cave1956supp — Stoutamire 1955
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type43 387 records
Wild obs. + sensor41 329
Museum / vouchered2 055
Other3
Origin
Native11
Introduced50
Range
Area of Occupancy AOO63 920 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy90% within 1 km
≤100 m 27 152≤1 km 4 115≤10 km 1 655>10 km 2 013
34 935 georeferenced · 6 394 without coordinates
Open the mapobservation + sensor41 329
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy33% within 1 km
≤100 m 97≤1 km 299≤10 km 611>10 km 202
1 209 georeferenced · 846 without coordinates
Open the institutions mapphysical evidence2 055
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions120 of 178 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Wuzhou, CN | 312 |
| Fort Worth, US | 299 |
| Lubbock, US | 105 |
| Tampa, US | 60 |
| Albuquerque, US | 56 |
| Pullman, US | 52 |
| EL PASO, US | 47 |
| Denton, US | 42 |
| Bangkok, TH | 39 |
| Emporia, US | 36 |
| Austin, US | 36 |
| Texas Lutheran Universitylocation not on record | 35 |
| BAYLUlocation not on record | 34 |
| DOI/NPS, Greenbelt Parklocation not on record | 34 |
| QAUlocation not on record | 32 |
| Bronx, US | 29 |
| Jena Microbial Resource Collectionlocation not on record | 28 |
| Chongqing Museumlocation not on record | 23 |
| Riverside, US | 23 |
| Flagstaff, US | 22 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 22 |
| Saint Louis, US | 20 |
| Phoenix, US | 20 |
| Denver, US | 19 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 16 |
| Bloomington, US | 15 |
| Allentown, US | 15 |
| Durango, MX | 15 |
| Miami, US | 15 |
| ASUlocation not on record | 14 |
| Taipei, TW | 14 |
| Brisbane, AU | 14 |
| US | 14 |
| University of Stellenboschlocation not on record | 13 |
| Stephenville, US | 12 |
| Kagoshima, JP | 10 |
| Beijing, CN | 9 |
| GAlocation not on record | 9 |
| Pretoria, ZA | 9 |
| CJBGlocation not on record | 9 |
| Burlington, US | 8 |
| Dekalb, US | 8 |
| TAIElocation not on record | 8 |
| St. Paul, US | 8 |
| Spearfish, US | 8 |
| Tuscaloosa, US | 7 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 7 |
| Claremont, US | 7 |
| Provo, US | 7 |
| Tsukuba, JP | 7 |
| Honolulu, US | 7 |
| Taipei, TW | 7 |
| Moscow, US | 6 |
| Chapel Hill, US | 6 |
| University of Southern Mississippilocation not on record | 6 |
| San Diego, US | 6 |
| Pittsburg, US | 6 |
| Norfolk, US | 5 |
| Nishihara, JP | 5 |
| CNF-UFHBlocation not on record | 5 |
| Chadron, US | 5 |
| Columbia, US | 5 |
| Guangzhou, CN | 5 |
| Davis, US | 5 |
| Ann Arbor, US | 5 |
| BISHlocation not on record | 5 |
| Montréal, CA | 4 |
| Lincoln, US | 4 |
| Taipei, TW | 4 |
| WNNUlocation not on record | 4 |
| Auckland, NZ | 4 |
| Fayetteville, US | 4 |
| Mississippi State, US | 4 |
| Valdosta State Universitylocation not on record | 4 |
| Changsha, CN | 4 |
| Universidad de Antioquia (UdeA)location not on record | 4 |
| San Angelo, US | 4 |
| Odawara, JP | 4 |
| LDlocation not on record | 4 |
| Christchurch, NZ | 3 |
| Kochi, JP | 3 |
| San Luis Obispo, US | 3 |
| National Institute of Biological Resourceslocation not on record | 3 |
| College Park, US | 3 |
| Stockholm, SE | 3 |
| Parkville, AU | 3 |
| Portland, US | 3 |
| Santa Barbara, US | 3 |
| Museo Entomologico de Leonlocation not on record | 3 |
| Jackson, US | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| Williamsburg, US | 2 |
| Ciudad Juárez, MX | 2 |
| New Haven, US | 2 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 2 |
| Wuhan, CN | 2 |
| Angwin, US | 2 |
| CASlocation not on record | 2 |
| Edmonton, CA | 2 |
| University of New Hampshirelocation not on record | 2 |
| Moscow State Universitylocation not on record | 2 |
| Boise, US | 2 |
| Tall Timbers Research Stationlocation not on record | 2 |
| Université de Bordeauxlocation not on record | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Waverly, US | 2 |
| Henderson, US | 2 |
| Mexico City, MX | 2 |
| Xinxiang, CN | 2 |
| Nanjing, CN | 2 |
| Uniwersytet Warszawskilocation not on record | 2 |
| Clemson, US | 2 |
| Guiyang, CN | 2 |
| Bern, CH | 2 |
| Québec, CA | 2 |
| Durban, ZA | 2 |
| Alicante, ES | 2 |
| Canberra, AU | 2 |
| GB | 2 |
| Little Rock, US | 2 |
| Dover, US | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| Karlsruhe, DE | 2 |
| Tulane Universitylocation not on record | 1 |
| UnBlocation not on record | 1 |
| Conway, US | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Minia, EG | 1 |
| Orem, US | 1 |
| Northridge, US | 1 |
| USFSlocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| Calabar, NG | 1 |
| AUAlocation not on record | 1 |
| Hangzhou, CN | 1 |
| Wuhan, CN | 1 |
| Juriquilla, MX | 1 |
| Hazara Universitylocation not on record | 1 |
| Fredericksburg, US | 1 |
| WINlocation not on record | 1 |
| Washington, US | 1 |
| Guasave, MX | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Mexico City, MX | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| Knoxville, US | 1 |
| Capital Normal Universitylocation not on record | 1 |
| Linares, MX | 1 |
| GJOlocation not on record | 1 |
| Columbus State Universitylocation not on record | 1 |
| Université du Lomélocation not on record | 1 |
| Smithsonian Institution, National Museum of Natural Historylocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Mexico City, MX | 1 |
| Henderson State Universitylocation not on record | 1 |
| Tartu, EE | 1 |
| Paris, FR | 1 |
| Chapingo, MX | 1 |
| Toronto, CA | 1 |
| Oskarshamn, SE | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Pocatello, US | 1 |
| MeiseBGlocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Kew, GB | 1 |
| Guilin, CN | 1 |
| Philadelphia, US | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| Grand Junction, US | 1 |
| South Kensington, GB | 1 |
| Smithfield, AU | 1 |
| Mount Annan, AU | 1 |
| Corvallis, US | 1 |
| Görlitz, DE | 1 |
178 institutions · 1 998 of 2 055 vouchered records shown · 57 without an institution code
09Environmental DNA17 detections
Where the DNA of Gaillardia pulchella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found17
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 17 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median22.9 °C 21.2–26.4
Seasonal swing summer↔winter21.0 °C
Max temp (day)28.8 °C 26.8–31.9
Min temp (night)18.2 °C 16.7–22.0
Precipitation106 mm/mo 87.9–114
Air humidity57.2 % 57.1–59.1
Moisture balance-67.2 mm/mo -73.0–-62.3
Vapour deficit1,201 Pa 1,081–1,414
Wind speed3.20 m/s 3.00–4.50
Cloud cover35.4 % 27.6–39.1
CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.