Gaillardia multiceps

Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Gaillardia

At a glance

Occurrence records104

Data sources11

Biological traits4

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Gaillardia multiceps's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility104 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Occurrence & distributionGBIF104 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 68

01Narrative

Gaillardia multiceps, the onion blanketflower, is a North American species of flowering plant in the sunflower family. It is native to the southwestern United States (Arizona, New Mexico, western Texas).Biota of North America Program 2014 county distribution map Gaillardia multiceps grows in gypseous soils, including sand dunes. It is an perennial herb or subshrub up to 45 cm tall, with leaves on the stem rather than clustered around the base. Each flower head is on its own flower stalk up to 55 cm long. Each head has 8 red ray flowers surrounding 80-100 disc flowers, yellow with purple tips.Flora of North America, Gaillardia multiceps Greene, 1897.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology1

Seed mass1.87 mg

Life cycle & reproduction1

Life spanperennial

Habitat & environment2

Climberself-supporting

Growth formSubshrub, Forb/herb

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gaillardia multiceps has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSDQ391208.1 ↗614 bp

ACGT

GAACAAGTACCTACATGCGGCTTTTTGGGTTTCGGGCTTTTGGTTCGAGACTCGGGAAGCCTTGCTACCGTGTGTTGATGACTTCCTTTT …

Gaillardia multiceps voucher Van Devender & Van Devender 85-124 (ARIZ) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Gaillardia multiceps carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 68 n = 34

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 681×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Zhao, Z. & B. L. Turner. 1993. Documented chromosome numbers 1993: 3. Miscellaneous U.S.A. and Mexican species, mostly Asteraceae. Sida 15: 649–653.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type104 records

Wild obs. + sensor19

Museum / vouchered85

Range

Area of Occupancy AOO296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 12≤1 km 2>10 km 1

15 georeferenced · 4 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 5≤1 km 7≤10 km 30>10 km 6

48 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence85

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Albuquerque, US	20
Lubbock, US	15
Austin, US	8
EL PASO, US	7
Wuzhou, CN	5
Riverside, US	5
Pullman, US	3
Flagstaff, US	2
San Angelo, US	2
Kew, GB	2
Pittsburg, US	2
Angwin, US	2
Fort Worth, US	2
ASUlocation not on record	2
Phoenix, US	1
Bronx, US	1
Taipei, TW	1
Chadron, US	1
Saint Louis, US	1
Hermosillo, MX	1
University of Stellenboschlocation not on record	1
Bloomington, US	1

22 institutions · 85 of 85 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Gaillardia multiceps was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)