Gaillardia coahuilensis

B.L.Turner · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Gaillardia

At a glance

Occurrence records99

Data sources11

Biological traits7

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Gaillardia coahuilensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility99 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Chemical compositionLOTUS · NPASS34 compounds

Occurrence & distributionGBIF99 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 34

01Narrative

Gaillardia coahuilensis, the bandanna daisy, is a North American species of flowering plant in the sunflower family. It is native to northwestern Mexico (Coahuila)Turner, B. L. 2013. The comps of Mexico. A systematic account of the family Asteraceae (chapter 11: tribe Helenieae). Phytologia Memoirs 16: 1–100. and the southwestern United States (western Texas).Biota of North America Program 2014 county distribution map Gaillardia coahuilensis grows in calcareous soils. It is an annual herb up to 20 cm tall, with leaves at the base and also higher on the stem. Each flower head is on its own flower stalk up to 35 cm long. Each head has 5-10 2-colored ray flowers (red, yellow, or orange close to the center of the head, orange or yellow farther away from the center). These surround 40-100 yellow or reddish disc flowers.Flora of North America, Gaillardia coahuilensis B. L. Turner, 1977.Turner, B. L. 1977. A new species of Gaillardia (Asteraceae-Heliantheae) from northcentral Mexico and adjacent Texas. Southwestern Naturalist 21: 539–541.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition34 compounds

Compounds documented for Gaillardia coahuilensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Pseudoguaiane sesquiterpenoids9

Chalcones4

Acyl phloroglucinols3

Flavanones3

Acyclic monoterpenoids2

Documented compounds34 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Alpinetin	present	NPASS
(-)-Pinostrobin	present	NPASS
(2,6-dihydroxy-4-methoxyphenyl)-[(1S,2R,6S)-3-methyl-2-(3-methylbut-2-enyl)-6-phenylcyclohex-3-en-1-yl]methanone	present	NPASS
(2S)-pinocembrin	present	NPASS
(3aR,4R,5S,5aS,6S,8R,8aS,9R,9aS)-4,6,8,9-tetrahydroxy-5,8a-dimethyl-1-methylidene-4,5,5a,6,7,8,9,9a-octahydro-3aH-azuleno[6,5-b]furan-2-one	present	LOTUS
(3aR,5R,5aS,6S,8R,8aS,9S,9aS)-6,8,9-trihydroxy-5,8a-dimethyl-1-methylidene-4,5,5a,6,7,8,9,9a-octahydro-3aH-azuleno[6,5-b]furan-2-one	present	LOTUS
(3aR,5R,5aS,6S,8S,8aS,9aR)-6,8-dihydroxy-5,8a-dimethyl-1-methylidene-4,5,5a,6,7,8,9,9a-octahydro-3aH-azuleno[6,5-b]furan-2-one	present	LOTUS
(3aS,5R,5aS,6S,8R,8aS,9R,9aS)-6,8,9-trihydroxy-5,8a-dimethyl-1-methylidene-4,5,5a,6,7,8,9,9a-octahydro-3aH-azuleno[6,5-b]furan-2-one	present	LOTUS
(6-hydroxy-4-methoxy-1-benzofuran-7-yl)-[(1R,2S,6R)-3-methyl-2-(3-methylbut-2-enyl)-6-phenylcyclohex-3-en-1-yl]methanone	present	NPASS
(7-hydroxy-5-methoxy-2,2-dimethylchromen-8-yl)-[(1R,2S,6R)-3-methyl-2-(3-methylbut-2-enyl)-6-phenylcyclohex-3-en-1-yl]methanone	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gaillardia coahuilensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSDQ391200.1 ↗614 bp

ACGT

GAACGAGTACTTACAATGTGGCTTTTTGGGTTTCAGGCTTTTGGTTTGAGACTCGGGAAGCCTTGCTACCAAGTGTTCTTGACTTTCGTT …

Gaillardia coahuilensis voucher Turner 96-11 (TEX) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Gaillardia coahuilensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 341×CCDB · eflora

CCDB · eflora

n 171×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Turner, B. L. 1977. A new species of Gaillardia (Asteraceae-Heliantheae) from northcentral Mexico and adjacent Texas. S. W. Naturalist 21: 539–541.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type99 records

Wild obs. + sensor24

Museum / vouchered69

Other6

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 7≤1 km 7≤10 km 3>10 km 1

18 georeferenced · 6 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 23≤1 km 10≤10 km 5

38 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence69

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Austin, US	50
Mexico City, MX	4
Fort Worth, US	4
Torreón, MX	2
Riverside, US	2
Austin, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Lubbock, US	1
Bloomington, US	1
ASUlocation not on record	1
Durango, MX	1

11 institutions · 69 of 69 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Gaillardia coahuilensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)