Gahnia xanthocarpa

(Hook.f.) Hook.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Gahnia

At a glance

Occurrence records984

Data sources5

Biological traits35

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Gahnia xanthocarpa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility984 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Occurrence & distributionGBIF984 records

DNA & barcodingNCBIsequences

01Narrative

Gahnia xanthocarpa is a tussock-forming perennial in the family Cyperaceae, that is native to New Zealand.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology14

Plant height2.5 m

Plant height max3.5 m

Seed length6 mm

Seed length max6 mm

Seed length min6 mm

Seed mass13.31 mg

Seed mass max13.94 mg

Seed mass min13 mg

Seed volume13 mm³

Seed volume max13 mm³

Seed volume min13 mm³

Seed width3 mm

Seed width max3 mm

Seed width min3 mm

Life cycle & reproduction9

Deciduousnessn.d.

⚠ sources differ — TRY: n.d. · GIFT: evergreen

Dispersal typeunspecialized

Life formperennial or rhizomatous geophyte

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formhemicryptophyte

Reproduction asexualpresent

Sex typeandromonoecious

⚠ sources differ — AusTraits: andromonoecious · GIFT: monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid

Habitat GIFTLowland

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gahnia xanthocarpa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ385572.1 ↗786 bpNew Zealand

ACGT

GGCGGTTCGCCGCCCGTGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAA …

Gahnia xanthocarpa voucher AK289506 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type984 records

Wild obs. + sensor798

Museum / vouchered185

Cultivated / captive1

Range

Area of Occupancy AOO2 144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 651≤1 km 67≤10 km 8>10 km 5

731 georeferenced · 67 without coordinates

Open the mapobservation + sensor798

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 3≤1 km 2≤10 km 10>10 km 1

16 georeferenced · 169 without coordinates

Open the institutions mapphysical evidence185

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	95
Auckland, NZ	41
Wellington, NZ	26
Museo Entomologico de Leonlocation not on record	8
Rotorua, NZ	6
Edinburgh, GB	2
Chicago, US	1
Brisbane, AU	1
Saint Louis, US	1
Palmerston North, NZ	1

10 institutions · 182 of 185 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)