Gahnia setifolia

(A.Rich.) Hook.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Gahnia

At a glance

Occurrence records672

Data sources6

Biological traits33

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Gahnia setifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility672 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources33 traits

Occurrence & distributionGBIF672 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 100

01Narrative

Gahnia setifolia (Maori): Māpere, Engels: Giant gahnia of Razor sedge) is een soort uit de cypergrassenfamilie (Cyperaceae). De soort is inheems in Nieuw-Zeeland, waar hij voorkomt op het Noordereiland en in het meest noordelijke deel van het Zuidereiland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology14

Leaf length max150 mm

Leaf width15 mm

Leaf width max15 mm

Leaf width min15 mm

Plant height1.75 m

Seed length4 mm

Seed length max4 mm

Seed length min4 mm

Seed mass5.03 mg

Seed mass max5.03 mg

Seed mass min5.03 mg

Seed width1.9 mm

Seed width max1.9 mm

Seed width min1.9 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeunspecialized

Life formperennial or rhizomatous geophyte

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formphanerophyte

Reproduction asexualabsent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTCoastal

Mycorrhizaabsent

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gahnia setifolia has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ385571.1 ↗785 bpNew Zealand

ACGT

GGCGGTTCGCCGCCCGTGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAA …

Gahnia setifolia voucher AK288670 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Gahnia setifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 100 n = 50

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1001×CCDB · new-zealand40

CCDB · new-zealand40

08Occurrence & distribution

Record type672 records

Wild obs. + sensor415

Museum / vouchered257

Origin

Native33

Range

Area of Occupancy AOO1 856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 265≤1 km 59≤10 km 6>10 km 8

338 georeferenced · 77 without coordinates

Open the mapobservation + sensor415

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 2≤1 km 6≤10 km 3>10 km 1

12 georeferenced · 245 without coordinates

Open the institutions mapphysical evidence257

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	88
Christchurch, NZ	84
Wellington, NZ	59
Rotorua, NZ	14
Palmerston North, NZ	3
Mount Annan, AU	3
Canberra, AU	1
Karlsruhe, DE	1
Chicago, US	1

9 institutions · 254 of 257 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)