Gahnia procera

J.R.Forst. & G.Forst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Gahnia

At a glance

Occurrence records1 433

Data sources8

Biological traits29

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Gahnia procera's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 433 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources29 traits

Occurrence & distributionGBIF1 433 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Gahnia procera is a tussock-forming perennial in the family Cyperaceae, that is native to parts of New Zealand.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology11

Plant height0.6 m

⚠ sources differ — GIFT: 0.6 m · TRY: 1.25 m

Plant height max0.8 m

Seed length7 mm

Seed length max7 mm

Seed length min7 mm

Seed mass17.06 mg

Seed mass max17.62 mg

Seed mass min17.62 mg

Seed volume15 mm³

Seed volume max15 mm³

Seed volume min15 mm³

Life cycle & reproduction8

Deciduousnessn.d.

⚠ sources differ — TRY: n.d. · GIFT: evergreen

Dispersal type detailedanemochorous

Life formperennial or rhizomatous geophyte

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formhemicryptophyte

Reproduction asexualpresent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Growth formherb

⚠ sources differ — GIFT: herb · TRY: grass

Habitat GIFTLowland

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gahnia procera has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ385570.1 ↗785 bpNew Zealand

ACGT

GGCGGTTCGCCGCCCGTGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAA …

Gahnia procera voucher AK289103 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type1 433 records

Wild obs. + sensor1 179

Museum / vouchered254

Origin

Native3

Range

Area of Occupancy AOO3 268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 1 044≤1 km 45≤10 km 5>10 km 6

1 100 georeferenced · 79 without coordinates

Open the mapobservation + sensor1 179

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 1≤1 km 3≤10 km 1>10 km 2

7 georeferenced · 247 without coordinates

Open the institutions mapphysical evidence254

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	139
Auckland, NZ	53
Wellington, NZ	47
Rotorua, NZ	5
Hobart, AU	1
Chicago, US	1
Kew, GB	1
Palmerston North, NZ	1

8 institutions · 248 of 254 vouchered records shown · 6 without an institution code

09Environmental DNA1 detections

Where the DNA of Gahnia procera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Gahnia procera

At a glance

Sources8 archives

Size & morphology11

Life cycle & reproduction8

Diet & foraging1

Habitat & environment8

Physiology & chemistry1

At a glance

Record type1 433 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 433 records