Gahnia clarkei

Benl · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Gahnia

At a glance

Occurrence records7 225

Data sources6

Biological traits31

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Gahnia clarkei's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility7 225 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources31 traits

Occurrence & distributionGBIF7 225 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Gahnia clarkei (also known as tall sawsedge)Common name is a species of evergreen plant from a sedge family that can be found in Australia. The plant is 1.5 - high, with the same width. They grow during summer and have large black to brownish flowers. The flowers contain heads that produce small red seeds.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology10

Fruit length2.75 mm

Fruit width1.65 mm

Leaf length500 mm

Leaf width45 mm

Plant height2 m

Plant height max2 m

Plant height min0.8 m

Seed mass3.4 mg

Seed mass max3.39 mg

Seed mass min3.39 mg

Life cycle & reproduction8

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timeyynnnnnnyyyy

Life formperennial

Life spanperennial

Pollination syndromewind

Resprouting capacityresprouts

Sex typeandromonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid tussock

Leaf compoundnesssimple

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gahnia clarkei has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLON594225.1 ↗625 bpAustralia · 2011

ACGT

AACGACATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGGTTTAAAGCAGGGGTTAAAGATTACAAACTTACTTATTATACTCCTGAA …

Gahnia clarkei voucher 600100030 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type7 225 records

Wild obs. + sensor6 720

Museum / vouchered410

Cultivated / captive3

Other92

Origin

Native215

Introduced1

Range

Area of Occupancy AOO11 624 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 5 489≤1 km 889≤10 km 214>10 km 15

6 607 georeferenced · 113 without coordinates

Open the mapobservation + sensor6 720

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 63≤1 km 73≤10 km 174>10 km 46

356 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence410

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	104
Museo Entomologico de Leonlocation not on record	83
Adelaide, AU	52
Canberra, AU	50
Brisbane, AU	43
Armidale, AU	25
NSW Dept of Planning, Industry and Environmentlocation not on record	16
John T. Waterhouse Herbariumlocation not on record	9
Kew, GB	7
Parkville, AU	3
Batemans Bay, AU	3
Wollongong, AU	2
EL PASO, US	1
Kensington, AU	1
University of the Sunshine Coastlocation not on record	1
Guangzhou, CN	1

16 institutions · 401 of 410 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Gahnia clarkei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 16.6–16.6

Seasonal swing summer↔winter10.6 °C

Max temp (day)22.6 °C

Min temp (night)11.7 °C

Precipitation55.4 mm/mo

Air humidity56.4 %

Moisture balance-57.4 mm/mo

Vapour deficit821 Pa

Wind speed3.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Gahnia clarkei

At a glance

Sources6 archives

Size & morphology10

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

At a glance

Record type7 225 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 225 records