Gagea tenera

Pascher · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Gagea

At a glance

Occurrence records63

Data sources9

Biological traits23

DNA specimens6

eDNA detections6

Sources9 archives

Databases and archives Gagea tenera's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility63 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF63 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Gagea tenera is an Asian species of flowering plants in the lily family. It is native to Xinjiang, Central Asia, the Western Himalayas, Iran, Turkey, and South Caucasus.Merkodovich, N.A. (ed.) (1941). Flora Uzbekistana 1: 1-566. Izd-va Akademii nauk Uzbekskoi SSR, Tashkent.Nikitina, E.V. & al (eds.) (1951). Flora Kirgizskoi SSR 3: 1-148. Frunze : Izd-vo KirgizFAN SSSR.Pavlov, N.V. (ed.) (1958). Flora Kazakhstana 2: 1-290. Alma-Ata, Izd-vo Akademii nauk Kazakhskoi SSR.Ovczinnikov, P.N. (ed.) (1963). Flora Tadzhikskoi SSR 2: 1-454. Izd-vo Akademii nauk SSSR, Moskva.Zarrei, M., Zarre, S., Wilkin, P. & Rix, M. (2007). Systematic revision of the genus Gagea Salisb. (Liliaceae) in Iran. Botanical Journal of the Linnean Society 154: 559-588.Zarrei, M., Wilkin, P. & Chase, M.W. (2011). Gagea Salisb. (Liliaceae) in Iran: an updated species checklist. Phytotaxa 15: 33-43.Zarrei, M., Wilkin, P., Noltie, H.J., Ingrouille, M.J. & Chase, M.W. (2011). Clarifying the nomenclature and taxonomy of Gagea kunawurensis (Royle) Greuter (Liliaceae) and allied taxa. Edinburgh Journal of Botany 68: 43-59. Gagea tenera is a bulb-forming herb up to 15 cm tall. Flowers are yellow- or yellow-green.Flora of China Vol. 24 Page 121 细弱顶冰花 xi ruo ding bing hua Gagea tenera PascherPascher, Adolf A. 1904. Sitzungsber. Deutsch. Naturwiss.-Med. Vereins Bömen "Lotos" Prag. 52: 128

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Leaf length120 mm

Leaf length max150 mm

Leaf length min90 mm

Leaf width max2.5 mm

Leaf width min1.5 mm

Plant height0.105 m

Plant height max0.15 m

Plant height min0.05 m

Seed mass0.195 mg

Life cycle & reproduction5

Flowering endApr

Flowering startMar

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTplains, stony places

Mycorrhiza typenon-mycorrhizal

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gagea tenera has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences6

eDNA detections6

Countries3

The DNA barcodea real sequence read deposited for this species

ITSEU912075.1 ↗517 bpIran

ACGT

TAGGCGGGGGACGGACAAAACCCCGGCGCGGCAAGCGCCAAGGATCATATAATTCGAGTAGAGTGCGGGGCGGCCCTTGCGGCCGCCGGC …

Gagea tenera internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Gagea tenera carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome records24–362n range36median36mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 363×CCDB · ipcn-api-dl · CCDB · eflora · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Davlianidze, M. T. & I. G. Levichev. 1987. Chromosome numbers in species of the genus Gagea (Liliaceae) from central Asia. Bot. Zhurn. 72: 1271–1272.

CCDB · eflora

CCDB · book-atlas-flowering-plants — Romanov 1936

2n 241×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — KOUL, A.K., & R.N. GOHIL. 1973. Cytotaxonomical conspectus of the flora of Kashmir (1) Chromosome numbers of some common plants. Phyton (Horn) 15: 57-66.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type63 records

Wild obs. + sensor39

Museum / vouchered24

Range

Area of Occupancy AOO216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 14≤1 km 4≤10 km 1

19 georeferenced · 20 without coordinates

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 6≤10 km 2

8 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	7
Astana Botanical Gardenlocation not on record	2
Kew, GB	2
BRNUlocation not on record	1
Wlocation not on record	1

5 institutions · 13 of 24 vouchered records shown · 6 without an institution code

09Environmental DNA6 detections

Where the DNA of Gagea tenera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 11.2–22.0

Seasonal swing summer↔winter27.8 °C

Max temp (day)27.6 °C 16.0–27.6

Min temp (night)13.9 °C 4.40–13.9

Precipitation5.50 mm/mo 5.50–29.6

Air humidity39.8 % 39.8–48.4

Moisture balance-124 mm/mo -124–-63.2

Vapour deficit1,940 Pa 1,049–1,940

Wind speed2.40 m/s 1.90–2.40

Cloud cover21.6 % 21.6–27.2

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)