Fusarium circinatum

Nirenberg & O'Donnell · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Hypocreales/Nectriaceae/Fusarium

At a glance

Occurrence records36

Data sources10

Biological traits0

DNA specimens44

eDNA detections65

Sources10 archives

Databases and archives Fusarium circinatum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility36 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI65 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF36 records

Environmental DNA4 datasets · 16 countries65 detections

DNA & barcodingBOLD · NCBI44 specimens

Genome at a glanceGoaT · NCBI≈47 Mbp

01Narrative

Fusarium circinatum is a fungal plant pathogen that causes the serious disease pitch canker on pine trees and Douglas firs (Pseudotsuga menziesii). The most common hosts of the pathogen include slash pine (Pinus elliottii), loblolly pine (Pinus taeda), Monterey pine (Pinus radiata), Mexican weeping pine (Pinus patula), and Douglas fir. Like other Fusarium species in the phylum Ascomycota, it is the asexual reproductive state of the fungus and has a teleomorph, Gibberella circinata.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fusarium circinatum has left across the world's sequence archives.

At a glance

DNA specimens44

Marker genes4

GenBank sequences10

eDNA detections65

Countries16

The DNA barcodea real sequence read deposited for this species

ITSPZ385194.1 ↗499 bpSlovakia · 2024

ACGT

TACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCC …

Fusarium circinatum isolate PS422 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

OtherAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Fusarium tricinctumsame genus5.6%Clonostachys roseasame order12.5%Colletotrichum incanumsame order13.4%Colletotrichum truncatumsame order13.8%Colletotrichum chlorophytisame order13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1CYTB

animal barcodefungal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_022681 ↗ · 30 protein · 27 tRNA · 2 rRNA

nad2LAGLIDADGnad3atp9cox2nad4Lnad5cobcox1GIY-YIGnad1nad4atp8atp6cox3nad6rps3small subunit ribosomal RNAlarge subunit ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Fusarium circinatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈46 833 576 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Fusarium circinatum0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness94% BUSCO

08Occurrence & distribution

Record type36 records

Wild obs. + sensor14

Museum / vouchered22

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 9≤1 km 1≤10 km 1>10 km 3

14 georeferenced

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 22 records without

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
DPIlocation not on record	2

1 institutions · 2 of 22 vouchered records shown · 18 without an institution code

09Environmental DNA65 detections

Where the DNA of Fusarium circinatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found65

Studies independent surveys4

Countries16

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 65 detections have coordinates

Open the map16 countries0

OceaniaNeotropicAustralasiaAfrotropicPalearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.3 °C 12.7–25.7

Seasonal swing summer↔winter3.80 °C

Max temp (day)25.2 °C 16.6–29.0

Min temp (night)15.5 °C 8.20–23.0

Precipitation90.5 mm/mo 60.1–200

Air humidity59.4 % 53.0–68.9

Moisture balance-37.0 mm/mo -63.1–95.3

Vapour deficit969 Pa 565–1,235

Wind speed2.10 m/s 1.20–4.30

Cloud cover36.7 % 25.6–49.5

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)