Fusarium acuminatum

Ellis & Everh. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Hypocreales/Nectriaceae/Fusarium

At a glance

Occurrence records167

Data sources12

Biological traits0

DNA specimens179

eDNA detections170

Sources12 archives

Databases and archives Fusarium acuminatum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility167 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI170 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics179 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS23 compounds

Occurrence & distributionGBIF167 records

Environmental DNA2 datasets · 7 countries170 detections

DNA & barcodingBOLD · NCBI179 specimens

Genome at a glanceGoaT · NCBI≈47 Mbp

01Narrative

Gibberella acuminata is a fungal plant pathogen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition23 compounds

Compounds documented for Fusarium acuminatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cyclic peptides $ Depsipeptides8

2-pyrone derivatives3

Trichothecane sesquiterpenoids3

Lupane triterpenoids2

Simple coumarins1

Documented compounds23 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Acuminatin	present	NPASS
(1R,3aS,5aS,5bR,7aS,9S,11aR,11bS,13aS,13bR)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-ol	present	NPASS
(1S,2R,4aS,6aR,6aS,6bR,8aS,10R,12aR,14bR)-10-hydroxy-1,2,6a,6b,9,9,12a-heptamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-4a-carboxylic acid	present	NPASS
(1S,3aR,5aS,5bR,7aR,11aS,11bS,13aR,13bS)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-2,3,4,5,6,7,7a,10,11,11b,12,13,13a,13b-tetradecahydro-1H-cyclopenta[a]chrysen-9-one	present	NPASS
(2S)-N-[(3R,4R,7R,10Z)-7-benzyl-5,8-dioxo-3-phenyl-2-oxa-6,9-diazabicyclo[10.2.2]hexadeca-1(14),10,12,15-tetraen-4-yl]-2-(dimethylamino)-4-methylpentanamide	present	NPASS
(3R,8R,9R,10S,13R,14R,17S)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(3s,6r,9s,12r,15s,18r)-3,6,9,12,18-Pentaisopropyl-4,10,16-trimethyl-15-sec-butyl-1,7,13-trioxa-4,10,16-triazacyclooctadecane-2,5,8,11,14,17-hexone	present	LOTUS
(7S,8S)-7-hydroxy-4-methoxy-7,8-dimethyl-5,8-dihydropyrano[4,3-b]pyran-2-one	present	LOTUS
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one	present	NPASS
4,10,16-Trimethyl-3,6,9,12,15,18-hexa(propan-2-yl)-1,7,13-trioxa-4,10,16-triazacyclooctadecane-2,5,8,11,14,17-hexone	present	LOTUS

05DNA & barcoding179 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fusarium acuminatum has left across the world's sequence archives.

At a glance

DNA specimens179

Marker genes5

GenBank sequences10

eDNA detections170

Countries18

The DNA barcodea real sequence read deposited for this species

ITSPV498715.1 ↗311 bpUSA · 2021

ACGT

CGGCGGATCAGCCCGCGCCCCGTAAAACGGGACGGCCCGCCAGAGGACCCAAACTCTAATGTTTCTTATTGTAACTTCTGAGTAAAACAA …

Fusarium acuminatum strain UROL F88 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1★ITS25-8S

animal barcodefungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Fusarium acuminatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈46 698 876 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Fusarium acuminatum0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

Completeness93.8% BUSCO

08Occurrence & distribution

Record type167 records

Wild obs. + sensor4

Museum / vouchered152

Cultivated / captive10

Other1

Range

Area of Occupancy AOO428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 2

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 1≤1 km 2≤10 km 7

10 georeferenced · 142 without coordinates

Open the institutions mapphysical evidence152

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the mapnot free-living10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	33
National Institute of Biological Resourceslocation not on record	7
Bernard Price Institute for Palaeontological Researchlocation not on record	6
Catholic University of Pekinglocation not on record	4
Pullman, US	4
Auckland, NZ	3
Université de Montréal Biodiversity Centrelocation not on record	2
Agriculture and Agri-Food Canada, Canadian National Mycological Herbariumlocation not on record	2
Bronx, US	1
TENN-Flocation not on record	1
Trondheim, NO	1
Sydney Medical Schoollocation not on record	1
Kensington, AU	1
CA	1

14 institutions · 67 of 152 vouchered records shown · 78 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA170 detections

Where the DNA of Fusarium acuminatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found170

Studies independent surveys2

Countries7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 170 detections have coordinates

Open the map7 countries0

Spruce(Softwood) dowel buried in soil of a c…Birch(Hardwood) dowel buried in soil of a co…Pine(Softwood) dowel buried in soil of a con…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.50 °C 0.8–18.6

Seasonal swing summer↔winter24.3 °C

Max temp (day)13.2 °C 2.20–24.6

Min temp (night)4.20 °C -1.10–10.5

Precipitation66.5 mm/mo 3.00–93.2

Air humidity66.8 % 38.8–71.3

Moisture balance30.3 mm/mo -165–52.0

Vapour deficit451 Pa 187–1,315

Wind speed2.90 m/s 2.70–5.50

Cloud cover50.0 % 24.4–56.4

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)