Funneliformis mosseae

(T.H.Nicolson & Gerd.) C.Walker & A.Schüßler · species

image placeholder — illustration coming later

Fungi/Glomeromycota/Glomeromycetes/Glomerales/Glomeraceae/Funneliformis

At a glance

Occurrence records1 171

Data sources9

Biological traits0

DNA specimens139

eDNA detections860

Sources9 archives

Databases and archives Funneliformis mosseae's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 171 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI860 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics139 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS12 compounds

Occurrence & distributionGBIF1 171 records

Environmental DNA13 datasets · 23 countries860 detections

DNA & barcodingBOLD · NCBI139 specimens

Genome at a glanceGoaT · NCBI≈146 Mbp

01Narrative

Funneliformis mosseae is a species of fungus in the family Glomeraceae, which is an arbuscular mycorrhizal (AM) fungi that forms symbiotic relationships with plant roots. Funneliformis mosseae has a wide distribution worldwide, and can be found in North America, South America, Europe, Africa, Asia and Australia. Funneliformis are characterized by having an easily visible septum in the area of the spore base and are often cylindrical or funnel-shaped. Funneliformis mosseae similarly resembles Glomus caledonium, however the spore wall of Funneliformis mosseae contains three layers, whereas Gl. caledonium spore walls are composed of four layers. Funneliformis is an easily cultivated species which multiplies well in trap culture, along with its high distribution, F. mosseae is not considered endangered and is often used for experimental purposes when combined with another host.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition12 compounds

Compounds documented for Funneliformis mosseae across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Isoquinoline alkaloids $ Protoberberine alkaloids6

Isoquinoline alkaloids2

Aporphine alkaloids $ Isoquinoline alkaloids1

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids1

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Tetrahydropalmatine	present	NPASS
Cycleanine	present	NPASS
Dehydrocorydalmine	present	NPASS
Palmatine	present	NPASS
Pronuciferine	present	NPASS
Roemerine	present	NPASS
Stepharanine	present	NPASS
Stepharine	present	NPASS
Stepholidine	present	NPASS
Tetrahydropalmatine, (+)-	present	NPASS

05DNA & barcoding139 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Funneliformis mosseae has left across the world's sequence archives.

At a glance

DNA specimens139

Marker genes1

GenBank sequences10

eDNA detections860

Countries23

The DNA barcodea real sequence read deposited for this species

ITSPZ142583.1 ↗573 bpTurkey · 2025

ACGT

TCCGTAGGTAAACCTGCGGAAGGATCATTTATGATTTTTAAAGCGAGTCGAGCGTTAAGCGAGGCTTGCGAAAATATTTAAAACCCCACT …

Funneliformis mosseae strain K13 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Funneliformis mosseae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈145 719 962 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Funneliformis mosseae0.15 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

07Deep time~34.2 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin34.2 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type1 171 records

Wild obs. + sensor11

Museum / vouchered1 160

Range

Area of Occupancy AOO1 304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 11 records without

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 5

5 georeferenced · 1 155 without coordinates

Open the institutions mapphysical evidence1 160

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
SAMRNlocation not on record	25
DPIlocation not on record	6
UAclocation not on record	5
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1

4 institutions · 37 of 1 160 vouchered records shown · 1 053 without an institution code

09Environmental DNA860 detections

Where the DNA of Funneliformis mosseae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found860

Studies independent surveys13

Countries23

Verifiable raw sequence linked26

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 860 detections have coordinates

Open the map23 countries0

PalearcticAfrotropicNearcticIndomalayan

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature17.0 °C 10.1–29.0

pH6.40 4.10–9.60

Conductivity96.0 µS/cm 10.0–163,200

Salinity35.2 PSU 34.7–35.6

Dissolved oxygen6.75 mg/L

Turbidity0.344 NTU

Organic carbon1.63 % 0.004–11.6

Water content10.4 % 1.71–50.8

Nitrate-N6.00 mg/kg 0.5–520

Phosphorus21.0 mg/kg 2.00–494

Clay20.6 % 1.91–71.7

Sand61.0 % 0–94.3

Depth0 m 0–7.00

SoilPelagicMarineTenosolKurosolChromosolVertosolCalcarosolPodosol

442 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 8.30–22.0

Seasonal swing summer↔winter12.9 °C

Max temp (day)19.2 °C 11.9–27.6

Min temp (night)9.60 °C 4.60–16.0

Precipitation55.7 mm/mo 29.3–83.2

Air humidity57.4 % 51.8–63.8

Moisture balance-52.2 mm/mo -128–22.4

Vapour deficit706 Pa 449–1,209

Wind speed3.60 m/s 2.60–4.90

Cloud cover23.9 % 11.8–44.8

CHELSA 1981–2010, ~9 km grid, at location & month of 770 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Funneliformis mosseae

At a glance

Sources9 archives

Compound class profile4 classes

Documented compounds12 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

Record type1 171 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type1 171 records