Fuchsia fulgens

Moc. & Sessé ex DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Onagraceae/Fuchsia

At a glance

Occurrence records281

Data sources11

Biological traits16

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Fuchsia fulgens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility281 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS10 compounds

Occurrence & distributionGBIF281 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT1.7 Gbp

01Narrative

Fuchsia fulgens, surnommé le Fuchscia brillant, est une espèce de plantes à fleurs du genre Fuchsia et de la famille des Onagraceae. Son aire de répartition naturelle est la partie centrale et le sud-ouest du Mexique. C'est un épiphyte qui est présent principalement dans le biome tropical saisonnier sec.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height1.2 m

Life cycle & reproduction7

Deciduousnessdeciduous

Dispersal typeanimal

Life formepiphyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Self fertilizationpresent

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climateseasonally dry tropical

Climberself-supporting

Epiphyteobligatory

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Epiphyte

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition10 compounds

Compounds documented for Fuchsia fulgens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavonols9

Dihydroflavonols1

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3S,4R,5S,6S)-6-[2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-4-oxochromen-3-yl]oxy-3,4,5-trihydroxyoxane-2-carboxylic acid	present	LOTUS
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one	present	LOTUS
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxy-2,3-dihydrochromen-4-one	present	LOTUS
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one	present	LOTUS
Astragalin	present	LOTUS
Hyperin	present	LOTUS
Kaempferol 3-rhamnoside	present	LOTUS
Quercetin 3-rutinoside	present	LOTUS
Quercitrin	present	LOTUS
Querciturone	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fuchsia fulgens has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAY357782.1 ↗631 bp

ACGT

GTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCACAGCAGAACAACCCGAGAACCGGTTCACAACCACTTGGGAGGCACGGGCAA …

Fuchsia fulgens internal transcribed spacer 1, 5.8S ribosomal RNA gene gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Fuchsia fulgens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 662 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Fuchsia fulgens1.66 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×GoaT · Kew Plant DNA C-values Database · CCDB · book-indian_vol1 · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-indian_vol1 — Warth, G. 1925

CCDB · kew — Talluri RS, Murray BG. 2009. DNA C-values and chromosome numbers in Fuchsia L. (Onagraceae) species and artificial hybrids. New Zealand Journal of Botany 47: 33-37.

n 112×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Breedlove, D. E., P. E. Berry & P. H. Raven. 1982. The Mexican and Central American species of Fuchsia (Onagraceae) except for sect. Encliandra. Ann. Missouri Bot. Gard. 69(1): 209–234.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type281 records

Wild obs. + sensor42

Museum / vouchered238

Cultivated / captive1

Origin

Introduced1

Range

Area of Occupancy AOO744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 20≤1 km 12>10 km 1

33 georeferenced · 9 without coordinates

Open the mapobservation + sensor42

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 122≤1 km 10≤10 km 17>10 km 6

155 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence238

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	91
Saint Louis, US	28
Autlán de Navarro, MX	24
Mexico City, MX	12
Austin, US	11
Austin, US	8
Giardini Botanici Hanburylocation not on record	8
Ciudad de México, MX	7
ASUlocation not on record	5
Tampa, US	4
Baroda, IN	3
Riverside, US	3
Mexico City, MX	3
Morelia, MX	2
Pondicherry, IN	2
Chapingo, MX	2
Phoenix, US	2
University of Stellenboschlocation not on record	2
MEXUlocation not on record	2
Beijing, CN	2
Provincia di Livornolocation not on record	1
Chicago, US	1
CASlocation not on record	1
Paris, FR	1
Wellington, NZ	1
Canadian Department of Agriculturelocation not on record	1
MAlocation not on record	1
Bronx, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
San Francisco, US	1
GB	1
Barcelona, ES	1
Auckland, NZ	1
Ann Arbor, US	1
Oskarshamn, SE	1
Madison, US	1

36 institutions · 237 of 238 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Fuchsia fulgens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)