Fuchsia encliandra

(Zucc.) Steud. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Onagraceae/Fuchsia

At a glance

Occurrence records263

Data sources7

Biological traits9

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Fuchsia encliandra's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility263 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF263 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT1.5 Gbp

01Narrative

Fuchsia encliandra là một loài thực vật có hoa trong họ Anh thảo chiều. Loài này được (Zucc.) Steud. mô tả khoa học đầu tiên năm 1840.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fuchsia encliandra has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOP711628.1 ↗215 bpMexico

ACGT

ACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGGAA …

Fuchsia encliandra voucher Pedro Tenorio L. 30022 (MEXU, US) ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Fuchsia encliandra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 471 890 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Fuchsia encliandra1.47 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×GoaT · Kew Plant DNA C-values Database · CCDB · book-ipcn67-71 · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-ipcn67-71 — BREEDLOVE, D.E. 1969. The systematics of Fuchsia section Encliandra (Onagraceael Univ. Calif. Publ. Bot. 53: 1-67.

CCDB · kew — Talluri RS, Murray BG. 2009. DNA C-values and chromosome numbers in Fuchsia L. (Onagraceae) species and artificial hybrids. New Zealand Journal of Botany 47: 33-37.

n 112×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BREEDLOVE, D.E. 1969. The systematics of Fuchsia section Encliandra (Onagraceael Univ. Calif. Publ. Bot. 53: 1-67.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type263 records

Wild obs. + sensor64

Museum / vouchered199

Range

Area of Occupancy AOO712 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 23≤1 km 6≤10 km 4>10 km 1

34 georeferenced · 30 without coordinates

Open the mapobservation + sensor64

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 121≤1 km 3≤10 km 8

132 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence199

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	54
Tuxtla Gutiérrez, MX	31
Juriquilla, MX	24
Mexico City, MX	21
Tapachula, MX	11
Saint Louis, US	11
Ciudad de México, MX	8
Chapingo, MX	4
Autlán de Navarro, MX	4
Austin, US	3
CASlocation not on record	3
MAlocation not on record	2
Tuxtla Gutiérrez, MX	2
Austin, US	2
Mexico City, MX	1
Tlalnepantla, MX	1
Davis, US	1
Guatemala City, GT	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
University of Stellenboschlocation not on record	1
Giardini Botanici Hanburylocation not on record	1
South Kensington, GB	1

22 institutions · 188 of 199 vouchered records shown · 11 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)