Fuchsia coccinea

Sol. ex Aiton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Onagraceae/Fuchsia

At a glance

Occurrence records92

Data sources8

Biological traits34

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Fuchsia coccinea's data was compiled from.

GBIFGlobal Biodiversity Information Facility92 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources34 traits

Occurrence & distributionGBIF92 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 44

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology10

Fruit length max17 mm

Fruit length min14 mm

Fruit width max12 mm

Leaf length max55 mm

Leaf length min15 mm

Leaf width max25 mm

Leaf width min7 mm

Plant height3.5 m

Plant height max1.5 m

Plant height min0.5 m

Life cycle & reproduction13

Deciduousnessevergreen

Flower colourpink

Flower length max42 mm

Flower length min18 mm

Flower width max4 mm

Flower width min3 mm

Flowering endDec

Flowering startJan

Life formscrambling shrub

Life spanperennial

Pollination modebiotic

Pollination syndrome detailedbee

Self fertilizationpresent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyte detailedterrestrial

Growth formshrub

Habitat GIFTCampo Rupestre

Leaf formovate

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Inflorescenceraceme

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Fuchsia coccinea has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY357776.1 ↗624 bpBrazil

ACGT

GTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCACAGCAGAACAACCCGAGAACTGGTTCACAACCAACTTGGGAGACATTGGCA …

Fuchsia coccinea internal transcribed spacer 1, 5.8S ribosomal RNA gene gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Fuchsia coccinea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome records44–442n range44median44mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 442×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Warth 1925

CCDB · book-atlas-flowering-plants

n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Hoshino, T. & P. E. Berry. 1989. Observations on polyploidy in Fuchsia sects. Quelusia and Kierschlegeria (Onagraceae). Ann. Missouri Bot. Gard. 76: 585–592.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type92 records

Wild obs. + sensor68

Museum / vouchered24

Origin

Native2

Introduced31

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 23≤1 km 34≤10 km 4>10 km 1

62 georeferenced · 6 without coordinates

Open the mapobservation + sensor68

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤1 km 3≤10 km 4

7 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	5
Bronx, US	4
Bern, CH	3
Chongqing Museumlocation not on record	2
IPA/SPlocation not on record	1
MAlocation not on record	1
FUNEDlocation not on record	1
Vancouver, CA	1
College Park, US	1
Kew, GB	1
Bangkok, TH	1
South Kensington, GB	1

12 institutions · 22 of 24 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Fuchsia coccinea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)