Frullania asagrayana

Mont. · species

image placeholder — illustration coming later

Plantae/Marchantiophyta/Jungermanniopsida/Porellales/Frullaniaceae/Frullania

At a glance

Occurrence records1 780

Data sources9

Biological traits1

DNA specimens19

eDNA detections19

Sources9 archives

Databases and archives Frullania asagrayana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 780 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 780 records

Environmental DNA1 datasets · 2 countries19 detections

DNA & barcodingBOLD · NCBI19 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Frullania asagrayana is a reddish-brown species of liverwort in the family Frullaniaceae that grows in eastern North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formnonvascular

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Frullania asagrayana has left across the world's sequence archives.

At a glance

DNA specimens19

Marker genes3

GenBank sequences10

eDNA detections19

Countries2

The DNA barcodea real sequence read deposited for this species

ITSHM746924.1 ↗279 bpUSA

ACGT

CGCTCGGCTGAAATCTATGTCCGTCCTGGAAATCGGAAGGGACGTTGCGAGAAGGTGCTCCGCTTTGCGAAAGTGGGCGGATGATATCAT …

Frullania asagrayana isolate SB3663 internal transcribed spacer 2 and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS9★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Frullania asagrayana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 91×CCDB · Cave1963

CCDB · Cave1963 — Iverson 1963

08Occurrence & distribution

Record type1 780 records

Wild obs. + sensor231

Museum / vouchered1 549

Range

Area of Occupancy AOO4 192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 112≤1 km 15≤10 km 8>10 km 52

187 georeferenced · 44 without coordinates

Open the mapobservation + sensor231

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 4≤1 km 187≤10 km 533>10 km 183

907 georeferenced · 642 without coordinates

Open the institutions mapphysical evidence1 549

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	271
New Haven, US	249
Knoxville, US	187
Bronx, US	163
Durham, US	138
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	95
Vancouver, CA	86
Saint Louis, US	54
Madison, US	54
San Jose, US	47
University of Stellenboschlocation not on record	26
Blacksburg, US	24
Oregon State Universitylocation not on record	17
PHlocation not on record	17
US	14
Chapel Hill, US	13
Cincinnati, US	12
Morgantown, US	9
College Park, US	6
WTUlocation not on record	6
Western Carolina Universitylocation not on record	5
LDlocation not on record	5
DOI/NPS, Colonial National Historical Parklocation not on record	4
Stockholm, SE	3
New Brunswick, US	2
Hudson, US	2
Fort Hayslocation not on record	2
EL PASO, US	2
Main Botanical Garden of the Russian Academy of Scienceslocation not on record	1
AUAlocation not on record	1
AADClocation not on record	1
Pittsburg, US	1
Asheville, US	1
Université Lavallocation not on record	1
US	1
Columbia, US	1
St. Paul, US	1
Hattori Botanical Laboratorylocation not on record	1
Portland, US	1
CASlocation not on record	1
Elocation not on record	1
Fayetteville, US	1
MAlocation not on record	1
Frankfurt am Main	1

44 institutions · 1 529 of 1 549 vouchered records shown · 16 without an institution code

09Environmental DNA19 detections

Where the DNA of Frullania asagrayana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median4.00 °C -4.40–12.5

Seasonal swing summer↔winter34.0 °C

Max temp (day)8.70 °C -1.10–18.4

Min temp (night)0.9 °C -6.50–8.20

Precipitation66.8 mm/mo 54.0–79.6

Air humidity61.2 % 57.3–65.1

Moisture balance-20.1 mm/mo -38.4–-1.80

Vapour deficit501 Pa 269–733

Wind speed5.70 m/s 5.60–5.80

Cloud cover47.1 % 36.7–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Frullania asagrayana

At a glance

Sources9 archives

Habitat & environment1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 780 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions27 of 44 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 780 records