Franklinothrips vespiformis

(D.L.Crawford, 1909) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Thysanoptera/Aeolothripidae/Franklinothrips

At a glance

Occurrence records202

Data sources8

Biological traits0

DNA specimens96

eDNA detections94

Sources8 archives

Databases and archives Franklinothrips vespiformis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility202 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI94 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics96 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF202 records

Environmental DNA2 datasets · 11 countries94 detections

DNA & barcodingBOLD96 specimens

01Narrative

Franklinothrips vespiformis, the vespiform thrips, is a species of predatory thrip in the family Aeolothripidae. It is found in the Caribbean, Central America, North America, Oceania, South America, Southern Asia, and Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding96 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Franklinothrips vespiformis has left across the world's sequence archives.

At a glance

DNA specimens96

BINs1

Marker genes2

eDNA detections94

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus90 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

90Amostly conserved

231Gmostly conserved

645Cvariable

GTCTTATATTTTATCTTTGGAATTTGATCAAGAATACTTGGACTATCTCTAAGAATATTAATTCGATTAACCTTACGAACAGGGGGAAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.42%

Haplotypes5

BIN1

Most divergent pair1.7%

N.AmericaS.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Franklinothrips megalopssame genus14.2%Franklinothrips orizabensissame genus16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type202 records

Wild obs. + sensor37

Museum / vouchered94

Other71

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 11≤1 km 5≤10 km 1>10 km 13

30 georeferenced · 7 without coordinates

Open the mapobservation + sensor37

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 76≤10 km 3

79 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence94

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	70
Laboratoire Biométrie et Biologie Evolutive, University Lyon 1location not on record	6
Universite Claude Bernard Lyon 1location not on record	3
Australian National Fish Collectionlocation not on record	2
University of Alberta Museums (UAM)location not on record	1
Champaign, US	1

6 institutions · 83 of 94 vouchered records shown · 11 without an institution code

09Environmental DNA94 detections

Where the DNA of Franklinothrips vespiformis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found94

Studies independent surveys2

Countries11

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 94 detections have coordinates

Open the map11 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…14. Artificial - Terrestrial | 14.2 Pasturel…Pretoriuskop??Sourveld3. Shrubland | 3.5. Subtropical/Tropical Dry…UrbanOpen forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 20.4–26.2

Seasonal swing summer↔winter2.40 °C

Max temp (day)27.7 °C 24.2–29.6

Min temp (night)21.7 °C 16.9–24.6

Precipitation86.9 mm/mo 11.4–388

Air humidity65.4 % 57.4–69.3

Moisture balance-58.5 mm/mo -158–600

Vapour deficit1,059 Pa 891–1,260

Wind speed3.20 m/s 1.10–7.20

Cloud cover30.6 % 13.6–56.7

CHELSA 1981–2010, ~9 km grid, at location & month of 88 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)